Transcript

her3-201

ID
ZDB-TSCRIPT-091203-33
Name
her3-201
Previous Names
  • her3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045569 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045569|OTTDARG00000032599|ZDB-GENE-980526-204 her3|OTTDARP00000035982 her3-001 LG_ CU693448.5 Danio rerio protein_coding KNOWN, 905 bp
CACTCAACTCAAGGAAGTCTGATAGTCCTTATTCATCTGG
ATTTTTTAAACACACTGAGCATTTAAGGACAATGGCTGCA
GCATCCAACAGTGCGGCGACGGCAAAACCCCAAAACGTTA
AAAAGGTTTCAAAACCACTGATGGAGAAAAAAAGAAGGGC
GCGTATAAATAAATGTTTGAATCAATTAAAGAGCCTTCTG
GAAAGCGCCTGTTCTAACAATATCCGCAAGCGAAAACTGG
AAAAGGCTGACATTCTGGAGCTCACTGTGAAACATCTGAG
GCATCTGCAAAATACGAAAAGAGGACTGTCCAAAGCTTGT
GACTCTGCTGAATATCACGCTGGTTACAGAAGTTGTCTCA
ACACTGTAAGTCATTATCTACGAGCGTCGGACACAGACAG
AGATTCCCGCTCCATCATGCTGACAAATCTTACGAGCGGT
CTTAACCACAATAGAGTTCCTGATTTCAGTACCGTGGAGA
GCGATCCCGCATTGATCTTTACACTACCAAGTACACTTCG
ACGACCACACAAAGTTCCCATTAGAACAGACGTCTCTTAT
TCCAGCTTTCAACAAACTGCAGAGAGAAAAGTTTGCTTAA
TGCCCAAGAGGACTGAGATTGGTGATAGCGACAGAATGTC
ATTGGACGCAGCTCTTAGGAGCCAGGAATCCAAAAAGGCA
GAAACCACACACTTCAGACCTAAAGATTTAAAGGTCATTG
AGTGCTGCATTTTCAAACAGAATTATTGGCGACCTTGGTA
GGCTAATGACTGCCCCTGATCTCATTGTTTTAACACTTAG
ACGTAAAAAAAAGACCTCTATTTTGCTTCTCATGCACTGT
GTATTTAGATTTTTTTTTCAAGAATGATGACGAATGTATA
TTTTATTAATAAACGTTTACAACAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations