header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-919
Transcript Name: synj1-201
Previous Names: synj1-001, dkey-184a18.5-001, ottdart00000043246

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043246 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043246|OTTDARG00000031101|ZDB-GENE-030131-9180 synj1|OTTDARP00000034285 synj1-001 LG_ CT027781.7 Danio rerio protein_coding KNOWN, 7800 bp
TTTCTGTTCTTAAACTACCTGCCCCGCTAATCATTTTGTT
TCTAGCCATATACGATATCCAACCGGGGCAAGACAGGCAC
AACTCTGACAGGACTGAAACAGGTTGTGTCGAGCCATGGC
ATTCAGTAAAGGTTATCGTATTTATCACAAGCTGGATCCA
CCTCCATACAGTGTGATTGTGGAGACCAGAAATCGAGAAG
AATGTCTGATGTTCGAGTCTGGAGCTGTTGCTGTACTGTC
GGCGGCAGAGAAAGAGACCATAAAAGCATCGTACACCAAG
ATGCTGGATGCCTATGGGATCCTGGGAGTTCTGCGTCTGA
ACCTTGGTGATTCTATGCTGCACAGTCTGGTGGTCGTAAC
AGGCTGCAGCTCAGTGGGAAAAGTCCAGGATTCAGAAGTT
TTTCGGGTAACAGGCACAGACTTTGTCTCTCTGAAGAATG
ACCCCACGGATGAGGACCGGATCGCTGATGTCAGGAAAGT
CTTAAACTCTGGGAACTTCTATTTCGCCTGGTCCTCAACT
GGAGTGAGTCTGGATCTCAGCTTGAATGCCCATCGCAGAA
TCAGAGAAGACACATCCGACAATCGCTTTTTCTGGAATCA
GTCCCTTCATCTCCATCTCAAGCATTATGGGGTGAACTGT
GACGACTGGCTTCTGAGATTGATGTGTGGTGGCGTGGAGA
TCCGCACCATCTATGCTGGGCACAAACAGGCCAAAGCTTG
TGTGATTTCTCGGCTCAGTTCGGAGAGAGCAGGCACACGT
TTCAATGTCCGAGGCACGAATGATGATGGCCAGGTGGCCA
ATTTTGTGGAGACTGAGCAGATTATTTTCCTTGATGACAA
AGTATCCTCCTTCATTCAGATCCGAGGGTCAATACCGCTA
TTCTGGGAGCAGCCGGGAATTCAGGTTGGATCCCACCGCG
TTAAGCTGTCCCGTGGTTTTGAAGCCAACGCGCCGGCTTT
TGAAAGACATTTCAGTGCTCTGAAAAGGCTGTATGGCAAA
CAGTTGATCATCAATCTTCTGGGAATGAAGGAGGGTGAAC
ACATGCTCAGCAAAGCATTCCAGAGTCACCTCAAAGCTTC
AGAGCATTCCAACGCTGTGAAAATGTTGAACTTTGACTAT
CATCAGATGGTTAAAGGAGGGAAGACTGAGAAGCTTCAGA
CTGTGCTGAAACCTCAGATCAGCAAGTTTGTGGAGGATTG
TGATTTCTTCTACTACTCAGGGGAAACCGGCATTCAGAGA
TGTCAAAGCGGAACCATCCGTTCCAACTGTCTGGACTGCT
TGGACCGAACAAACAGCGTCCAGGCCTTTATTGCACTTGA
GATGCTTCCCAAACAGCTGGAAGCCATGGGTTTGACAGAG
AAACCTCAGCTGGTGGCTCGTTTTCAGGAGGTTTTCCGCT
CCATGTGGTCCACCAATGGAGACTCCATCAGCAAGATCTA
CGCAGGCACTGGTGCTTTAGATGGCAAGGCTAAGGGCGGA
AAGCTAAAAGATGGAGCTCGCTCGGTCACCAGAACCATCC
AGAACAACTTCTTTGACAGCTCTAAACAGGAAGCCATTGA
CATCCTGAGACTGGGCAGCACCCTTAACAGTGACCTGGCA
GATAAAGCACGAGCACTTCTCACGACAAGCAGCCTATATG
TCTCTGAGCCAATTTTACAGTCAGCCTCTCCAAGGGTGCT
TCTAGGCATGTGTCAGAACCACTTCAAATACACTCGGCCC
AAGAAGATCCGAGTATGTGTGGGAACGTGGAACGTAAATG
GAGGCAAACAGTTTCGCAGCATTGCGTTTCGTAACCATAC
GCTCAACGACTGGCTTCTGGATGCTCCTAAGAAAGCCGGA
CACCCAGAATTTCAGGATGTCAAAAACAACCCTGTGGACA
TCTTTGCTATTGGTTTTGAGGAAATGGTGGAGCTGAATGC
TGGTAATATAGTCAGCGCAAGCACCACAAACCAAAAGCTG
TGGGCCGCAGAGCTGCAGAAGAACATCTCCCGAGATCAAC
GATATGTCCTGCTGGCCTCAGAACAGCTGGTCGGTGTGTG
TCTTTTCGTCTTCATTCGCCCTCAGCACGCACCCTTTATC
AGGGATGTTGCTGTAGACACAGTGAAGACTGGAATGGGCG
GAGCCACTGGTAATAAGGGAGGCGTGGCTATTCGTATGCT
CTTCCACACTACCAGCATCTGCTTCGTGTGTTCGCACTTT
GCTGCCGGTCAATCACAAGTCAAAGAGAGGAACGACGACT
ATAATGAGATTGCACGCAAACTGTCCTTCCCCATGGGTCG
TCTTCTGTACTCTCATGATTATGTATTCTGGTGTGGAGAC
TTCAACTACCGAATCAATATTCCCAATGAAGAGGTGAAGG
AGCTGATCAGACAGCAGAACTGGGATGCACTTATTGGTGG
AGATCAACTGGTGGAGCAGAAGAATGCAGGACAGGTCTTC
AGAGGCTTTATTGAAGGAAAGCTGGATTTTGCGCCCACTT
ATAAATACGACCTTTTTTCTGAGGATTACGACACTAGTGA
GAAGTGCCGCACACCGGCCTGGACCGACCGTGTGCTGTGG
AAAAGAAGAAAGTGGAACTTTGATAAAACTGCGGAGGAGT
TGGAGTTGAATGTAGTAGGAGCTCCAGTGAATGAGGAAGA
ACAGTATCCATGGAGCCCTGGAGACCTCAAGTATTACGGC
AGAGCTGAGCTGAAAACCTCTGATCACAGACCTGTGGTGG
CCATCATAGATGTGGACATACTTGAGGTGGATCCCGAGGC
TCGTCATCAGGTGTATAAGGAAGTGATCGCCCTGCAGGGT
CCTCCCGACGGCACCATCCTAGTCTCTCTCTGCTCTTCTG
GTCCCGATGACTACTTTGATGATGCTTTAATTGACGATCT
TTTGGACAAGTTTGCTAATTTTGGCGAGGTTATTCTTATC
AGGTTTGTTGAAGAGAAAATGTGGGTGACATTTTTGGAGG
GATACTCAGCTCTGGCCGCTCTGTCTTTGAGTGGGTCTAC
TGTGAATGGAAAGACCATAGACATCCGCCTGAGGAGTCCT
GGATGGATAAAGAGTCTTGAGGAGGAAATGAGTGTGGAGA
GAATCTGTGGTAGTATTCCAACATCCACCAGCTCCACCCT
GCTGGCAGAAAACTCTGACCTAGGAGAAGAGTATGACATG
GAAGGTGATGTGGACGAGGAGGTTGAGGATATTTTACCCC
AGCACCTGCAGCCTGGAGCAGGCATGGATCTGAGTGCGTC
TCCTGCCACATCTCCACGCACCAGCCCATGCCCTTCACCC
ACTCACGGAGAGCCAGCACCACCCATCCGACCCAGCAGAG
CGCCACCACGCACAGCCGGACCACCACAGGGTTCTCCAGT
TGATGGTCAGCCAGCAGGAGCTCCATTCTCACAGGGACTA
GAGCCAAAACGTCCCCCTCCGCCTCGCCCTAATGCCCCGC
CAGCCCGACCTGCACCTCCACAGCGCCCACCACCACCCTC
AGGTCGAGGTCAAGCCACCGGACCAGCTCCTGGAGGCATC
CCAAGGCCGATCCCACCCCGAGCAGGAGTCATCAGCGTCA
CGCCTCAGGCCAGACCTCCTCCTCCTGCTCATCCCGGGGC
CCCCAGACCCACAGCAGAGGTGCATCCTGGAGCCCCTCGA
CCCTCACCAGATAATCATCCCGGAGCTCCAAGACCCACTG
CTGAACCCCAAAGCAAACCGTCTGAGCTGCCTCTGGGTCC
ACCCCTGACACTGCCAGGTCCCGTAAGGCCTCAGATGACA
TCACCCATGCAGCCTCAGTCTGTGTCGCCCGTTCAGCCTC
CAGTCCAACCCCAACTGCCCCCACCCATACAATCCCAGCT
CCCTCCACCAATGCAGCCCACCTTACCTGCTCCTCTGATG
CCTCAGCAGGCCCCTCAGACATCAGCCGGAGCCGGAGCCG
CTGCCGCCCCTCAGCCTGGACTGGCATCTCCCAAACCTCC
ACCCCGCAGCCGTTCCTCTCATGCACTGCCACCTGAATCT
GCTCCAGCTCCAACAACACAGCAGGAGCAATCCTCAGGTT
AACAGGCCAAGAACATGAATGGAGTCCAAAGAGAAGCACA
ATGGAACCTAGACCCCTTCGACATGCTTAACCCTCAATCC
CTCTTCCAGAACACACCATTCACCGCTTCCCTCTCTCGCT
CCTCATCCTCCTCTACATCCACTCCATCCCCTTCTTCCTC
ATCCTCAACGTTACCCAGCAACCTTTCCCTGTTCTCAGCT
CCGGACACCAGCAGCGCTTCGTGTCTCCTCGCTCCCCCCG
CCCCATCCCGCAGCAAATCCCAAGAGACCCTCCGTTGCTC
CCCTAATCCATTCCTCACAGACATCCAACCAAGACCCAAC
AGCACCAACCCCTTCACCAGCGGGCTGCAGTCCTCCCCGC
GCCGATCGCTTACACCTGATTTCTACACCCAAATGCAAGC
CTCTAAACCTGATTTCAATAGAGCTATGTCTGCTGTAGGC
CACAGTTCCACCCTTCCTCCAACGTTCTCCCGACAACAGT
CCTTAGTTACTGCTACAGCTCCAGCCCCCAACAAACAAAC
GCAAAAGTGGGTCACCTTTGATGATGATTTGGATTTCCTT
TCAAAAAGGGTTGGGACCGGCCCATTAGCTTCACCTCTTC
CTTTTCCACAAACCCAAAGCAGTTTCCCAAGCTCAGGCTT
TGGCATGGACAACAACTGGGCATCGCTTCCCACCTCTGCA
TTCCCAGCAATCCCTCCGCCTGTACCAACCCGGACTAATA
CCAGCATCAAAAACGCCCAACTCCCTTCCAGAAATGATTT
CACAGAGAGATGATATAGAATGGATGTTAAATATGAAGGA
AATATTATTGCGTATATGTATGGTTTGTATAAAAGTGCAG
ATATAATGACCTGTTCGTACAAAAAAAAAGGTAATCTGGC
TGTTTATTTTAGCCCAATGTGGGCAGGAAATCAAGACTAA
ATGCTCTTCAGATTTGAATATGTTGTCATTTGCAAACATA
TGCATTGCAGCATTTAGCATATTGCACAAGCTACATAATC
ATTTGTAAAAAATGTACAAATGTTAAATGATATATCTCAT
CACAACGTCGATGTAATCGTTTTAATCACCCTCATGTCGA
AACACAAAAATGAGAACTGTACTCTTTATTTTGGACTTTC
ATTATACACTCAAATCCAGTTCTATAATATGTTCTTAAGA
AGAAACAAATAGACATGAAATGAGGGTGATTAAATAATGA
TTATTCCTAATTTTATTCATCAAATATCCCTTTATTCTAT
AACCCAATACATCCCAAGAGAAACATGCTCTTATCATACG
CACAGATTTAAAATGCCTGGCTGCGTCTGACCTGTTCTAC
ACCATCATATCTGTTCAATGGGCTTCACGTGAGCTGTGGT
ACATGCATACATATTTTACTTTTGCCGTTAATCTCATTAT
GAATGTATTCACCTGTTTCTGTTGCCTACATTTAGGTTTA
GAACGTGCGTCATGTGCAGCATTAACAGATGCTTTGCTGC
AAACTCAAATCGAGGGTCTTAACTTCTCTCGGTGTTCATG
CTATGCTAAAGACCCCGTGTCCCAGCCTCAGCACATCCTG
TAGCTATATATCGTTGTCAGAATATATCTTCAACACATAT
TCATAGTGATTCTATGTCTTCCTAGTGAGGAAAAAAAATG
TAAAGTGATTCTGGATTGTGTTTATATTTGCAGCATATAC
AGTACATGCCATATCTAAAGTGCACTGAAAAGCTCCGTCT
GTCTTCTAGGCTGTATTTGTTTCGCGCGGCGGCTCCTCTA
ATTCATCGACACTGTATATACATGTCCTTTCAGTTTACCC
AAAGCTCACCACAGAACTGCTGTATTTATCAAACGTGTTG
TGCGCGTGATTGAATTGGTAAGTTCCTCCTTCAGGATGTC
GGTCATGCTTTCTTTTGTGCAATGTGTACCTAATCGCTCA
ATGAAATTGTATTTTTTAAGTTGAACAGGTTGTTGATAAT
CTATTTATTGTCGTGTGTGGAGGAATACTGTGCTGTATTT
TGGAGTGCGTCGTCTGTTTTTGTGTACTTTAGCTGTTTTG
CGCGAATGCGCTTGCGTGTTTGGATGGTAATGTTGAGGGT
TTCTGGTGTCTTTGTTACATGTCTGCTGACCCCAGTGTCA
TTATTGCATTACATCTTCGTTGTTTTAGCGATGCAGATTT
ATTATGGTATCAACTATGGTTCATTATTGACAGTAAGGTG
GTCTGTTAAATTAATATTCCGTCATGTTTACTCACACTCA
TGCTGTCCCAAACTGGAACCAAATCTTCAAAACACAATTG
AAATGGACATTTCTGTCCTTACATTGAAAGTCTTCTCATT
CAGAACTCTTAAAGGGATCAAATCAACTAATAAATATTTA
TAATTTATAGCTATTTTCAAAGTGTTTTATGGGATGAAAA
GATTTGATTAGTCTTTCATTCACATACAAACACAGATCAG
CAAACCATGTTCAACAGCATTTCACTTTGGCATGCTTGCT
TGACGCATGAGAACCAAGCAGGTTTGTTTTTGCTCGTCAC
ATGGCAAGCTGAGCTTCTGTAAGAAACCAGTCAGTTTTAT
TCTAAAGTATCAGTGCTTGCATTTCTGTTTATGGTTGCAA
ATTAGTGTTTATATATGAATAAAAGCTTAAATGAAATCTG
CCCAACCACATTTATGTATTTTTAGATCTCTTCATGAATA
ATTTAAAGTAAGTTTTGGATGAACTAACTTTTAATACAGG
GTTAGAATTGCTTAGAAATGTCTTCATTTTGGTTCTGAAG
ATAAAAATTTTGGTTTGGATGTCATGAAGGTGAGTAACTG
AAAACAAATTGTAATTTTTGAGTGAACTAACCCTTAAAAA
GATTATGAATGGTGTAATATGTATGTTAATAATGCTTTGT
TGATAAAAGTAAGATATTTTGGCGAATTTCAAATGTGTTT
GAGCTCCCAGATGTGTTCAGTTTGTATAGCATTCCAGACG
GTGTACTGATGCATTATGGGTGAGTGATCTGATTTTATGT
GTGCAGTCATTTTTATTAATGTTATGCAGGTTTTTAATGT
CCCTCAAGGGCGTCATGAAACCATTCCTGGTTATAGTGTA
AAGGTGTTTCAGGAAACAGTATTTTATTTGTGCTTCTGTT
CCTTGTTTACATTTTAGGTACAAATTTAACATCTGCGTGG
CTTTTCATATGTTCGCCTGGGACGTGTTGAGCGACGCATT
TTGGCTTTGAGCATTACAGATTTATTTATGTAAAGCACTG
AAAGTTTTTGGTTGAACAAGGGGTCAGAGGAATGCCAGCC
AGCAGGAATTATTGCAAAGATTTATATTTGAATTAATGCA
TGAGAAACCATTTCAAAATGCATTCCAAAGCATTAACTGT
GAACATCTCCAGAATACAGACTAGTATCAGGTTGTGGATA
ATATTATTTATTTTTTCTTTAATGACTGATAAACGCAATG
TAACCACTTAGCATTCAAAAGCATTTGTTCTGTATGTAAT
CAAAGCATTAATCCGGACATTGTCTGCAACAGTCATTAAT
GAGAAGCAAGGTTTTCTAGAAATAATCGACTCCTTTTGCG
AAGTTAACGTTCCTTTGTAGCTTTTAGCCCAGTAGTGAAC
AGAAGTCTGTGGTATTAACCTTATATGTATGTAAAGACAA
ACCACAAAACTACAACTCGAATATTGGATCTGTAATTGAA
GTGCATACCAAAAGTGCACATTTATGTATGGAGCAATTGA
TGTTGTATGTATGCAATAATAAATGTAATTCAACATGAAA

synj1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA synj1-201 7800
ncRNA synj1-002 (1)    Ensembl 759
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
synj1-201 Contained in:
[BAC] DKEY-5G14 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000043246 (1),  Ensembl_Trans:ENSDART00000134276 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AY736013 (1) 4864 bp
CITATIONS (2)