ZFIN ID: ZDB-TSCRIPT-091110-1645
Transcript Name: synj1-002
Previous Names: dkey-184a18.6-001, ottdart00000043247

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043247 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043247|OTTDARG00000031101|ZDB-GENE-030131-9180 synj1|no_translation synj1-002 LG_ CT027781.7 Danio rerio protein_coding KNOWN, 759 bp
GAGCATTCCAACGCTGTGAAAATGTTGAACTTTGACTATC
ATCAGATGGTTAAAGGAGGGAAGACTGAGAAGCTTCAGAC
TGTGCTGAAACCTCAGATCAGCAAGTTTGTGGAGGATTGT
GATTTCTTCTACTACTCAGGGGAAACCGGCATTCAGAGAT
GTCGTTATATATGAATATGTACAATGTATTAAAACGTTTA
AAATTCGTAGCAAATGCGTTTTTCACTTCACTGTTTCAGG
TAAAGTTTCTTTGGTTTCTGTGTTTGTGGTCACGGTTTAT
GGGATCAGTCTGCTGTAGTGGACTGATTTCAACATGTGGA
TATGGATTTGAATGAGTTTCCTAATGCTAGCGTGCTAATC
TGCGGCTCCCGGCTGCTTTGGGTGTGAGATTAGCTCTGAA
CCAGAGGGCTAATGCTGTTATCTGTCTAACGGCTAACTGT
TAACCTCTCTCTCTCTCTCTCCCTTTCTTTTCTCTTCAAT
GCTTGCAACGTTAGTCTCTGAGCCAATTTTACAGTCAGGT
ATAGTATACACAAACCGACCATAAATCCATAACTGTTTAT
GGTTCCCTGTTTCATAAAATCAGTGTTTATTTTGGCGCTG
CTGACTCTGTGCTGTGTGTTTGTACTTCGTGTAGCCTTTT
ACTATGGTGTGTTGTCTTGTTTTTTATATTTCTATCCAAC
TTTTAAGGACAAAATTCTGTCTTTTTGTTGTCTCTCATAG
TGGTTTGATTAATGTCATCAAGATCTAATATGTTCTAGA

synj1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA synj1-201 (1)    Ensembl 7800
ncRNA synj1-002 759
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
synj1-002 Contained in:
[BAC] DKEY-5G14 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000043247 (1),  Ensembl_Trans:ENSDART00000139056 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CT696693 (1) 778 bp
CITATIONS (2)