Transcript

slc6a16a-002

ID
ZDB-TSCRIPT-091110-678
Name
slc6a16a-002
Previous Names
  • ch73-160p19.2-001
  • dkey-29b22.6-002
  • si:dkey-29b22.6-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045328 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045328|OTTDARG00000032448|ZDB-GENE-061009-43 slc6a16a|no_translation DKEY-29B22.6-002 LG_ CR847509.9 Danio rerio protein_coding NOVEL, 762 bp
TGATTCATCTGAAATGTTTTATTTTAATGTTGTGTGTAAC
TTAATGGTTCATAAAAGCTTTTCTAAACCTCTGTCTCGCT
CCAGGTGCATTTATGCTACTATATGTGATGCTGCTGTTGA
TAATCGGGGTACCTCTGTTCTTCATGGAGCTGGCAGCTGG
GCAGAGCATCCGGCAGGGCAGCATCGGGGTCTGGAAACAC
ATATCACCTCGTCTCGCCGGCATCGGTTACTCCAGCTGCA
TGATTATTCCTACTTGTTCAAGTCCATCCATCCTGTTTGC
CTTTCTCTCAGGGAGTGGAGGGAACGGGTTTGGCGTTTAT
AGCGTTTACTGAAGCGATGGCTTTGTTTCCTGCGAGTCCA
TTTTGGTCGACGCTGTTCTTCCTCATGCTGCTGAATTTGG
GCCTGTCCACCATGTTTGGCACCATGCAGGGTATTCTGAC
CCCGCTCATGGACAACTTCCGAGTACTGGGACGCCACAAG
ACCATGCTGACAGGTACACACAAATAGACACGTAAATACT
AAAGGATTTTGAGTTCTAGCTCTAAATGTCACATCATGTG
TTTAATCTGCAGTGTGTAGCTGTATTCTGGGCTTCTTCAT
TGGTCTGCTCTTCACTCAGAGGAGTGGCAACTACTTTGTG
ACCATGTTCGATGATTATTCTGCCACGCTGCCACTGATCA
TTGTTGTCATTTTTGAGACCGTCAGCGTGGCGTGGATTTA
CGGTGCAGATCGGTGAGGAATCTTTGTTTTATATGCTGAT
TA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations