Transcript

slc6a16a-203

ID
ZDB-TSCRIPT-090929-6624
Name
slc6a16a-203
Previous Names
  • dkey-29b22.6-001
  • slc6a16a-001
  • ottdart00000023602
  • si:dkey-29b22.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023602 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023602|OTTDARG00000032448|ZDB-GENE-061009-43 slc6a16a|OTTDARP00000019600 DKEY-29B22.6-001 LG_ CR847509.9 Danio rerio protein_coding NOVEL, 1760 bp
CTGTCCAGATGGAGAAGCCGCCATTGCCCAGTGATGAGAA
TGGAAGTGTGTTGACGGAGAGCCAGTCAGACATGGCTCTG
GTGTCTGCAGATGATGAAGGGTCTGCGGGCGCTGATGGCC
AAGAGGACGACAGGCCAGCATGGGACAGTAAACTGCAGTA
TGTTCTTGCTCAGGTGGGCTTTAGCGTTGGATTGGGCAAT
GTCTGGAGATTCCCTTATCTGTGCCACCAAAATGGAGGAG
GTGCATTTATGCTACTATATGTGATGCTGCTGTTGATAAT
CGGGGTACCTCTGTTCTTCATGGAGCTGGCAGCTGGGCAG
AGCATCCGGCAGGGCAGCATCGGGGTCTGGAAACACATAT
CACCTCGTCTCGCCGGCATCGGTTACTCCAGCTGCATGGT
TTGTTTCTTCGTGGCCCTGTACTATAATGTGATCATTGCC
TGGTCTCTGTTCTATATGGGGAATTCATTCCAGTATCCAT
TGCCTTGGGAACAGTGTCCTGTAGATATGATCTCAAATCA
GACAGTGAAAGAATGTGCTGCAAGCTCTCCTACCTCATAT
TTCTGGTTCAGGAAGGCTCTGGATATCTCAGACTCCATAG
ACCAGTCAGGAGAGTTTAACCCCATCATGACCGGCTGTCT
TCTTGCCGCTTGGGCTATAGTGTGTCTCGCCATGATCAAG
GGCATCAAGTCTTCAGCCAAGGTGATGTATTTCTCCTCTG
TGTTCCCTTACGCAGTGCTCATCTGTTTTCTCATCAGAGG
CCTCATGCTGGACGGAGCAATAGATGGCATCAAATATATG
TTTTATCCTAAGGTGGAGATTTGGGGGGAGGTGCAGGTCT
GGCGTCAGGCTGCCACTCAGGTCTTCTTTGCTCTGGGTCT
GGGTTACGGCTCTGTGATCGCTTATTCGTCCTACAACCCT
ATTCATAACAACTGCCACCGGGACGCCATCATGGTCTCTG
GCATCAACTTCATGACCTCAGTGCTGGCCTCTCTGGTTGT
CTTTGTGGTCCTCGGTTTTAGAGCCAAGAACATCGCTCTG
GATTGTGTCGCAACGAACGTGGCCAGAATGGCAGAAATGG
CACAGACTGGCTCATCTCAGCACTGGCGGCCATTGTTCAA
CATGTCCGACCCTAAATCAGTGGTTCTTCAAGACTACAGG
CAATGGTACAGCAGCTACGGAAGCCTGCTAGGATCTAATA
TCACTGACTGTGACCTGGAGAGAGAAATGAGCAAGGGAGT
GGAGGGAACGGGTTTGGCGTTTATAGCGTTTACTGAAGCG
ATGGCTTTGTTTCCTGCGAGTCCATTTTGGTCGACGCTGT
TCTTCCTCATGCTGCTGAATTTGGGCCTGTCCACCATGTT
TGGCACCATGCAGGGTATTCTGACCCCGCTCATGGACAAC
TTCCGAGTACTGGGACGCCACAAGACCATGCTGACAGTGT
GTAGCTGTATTCTGGGCTTCTTCATTGGTCTGCTCTTCAC
TCAGAGGAGTGGCAACTACTTTGTGACCATGTTCGATGAT
TATTCTGCCACGCTGCCACTGATCATTGTTGTCATTTTTG
AGACCGTCAGCGTGGCGTGGATTTACGGTGCAGATCGGTT
CTTGGATGATGTGGAAGTGATGCTACATTGGCGCCCTCCG
GTGGTTTACCGTTATTTGTGGAAGTATGTGTGTCTGCTCG
GCATGGTGGGTCTGCTGGCTGCTAGTCTTCTCCGCATGGT
CTTCAAACGGCCCACGTACACTGCCTGGAACCACACCACG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations