Transcript

il20ra-002

ID
ZDB-TSCRIPT-091110-587
Name
il20ra-002
Previous Names
  • crfb8-002
  • dkey-161j23.3-001
  • ottdart00000044825
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044825 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044825|OTTDARG00000032144|ZDB-GENE-040724-249 il20ra|no_translation crfb8-002 LG_none BX072559.10,CU928154.6 Danio rerio protein_coding KNOWN, 1098 bp
AACACCTGAGCAGAAGAAGATGGACTTTGAGAGACGGCAG
TGTGTTGAAAACTTCTCCAGCTTCATGTAGAGCAGAAAAC
ACAGCTTAAAAAACAGAAAACCCGGCAGAATGCCAGCACT
TCAGCGATGGATGTAGTTTTATCGATCTGTCTGTGTTTTC
TCCTCAGAGCGCTGTCAGCGTCATCTGCTGATGGACCGCC
TGAGCCGCGAGACGTCCACTTCTACTCGGAGAGTTTGAGG
AACGTGGTGAAGTGGACGGCAGGACACGGATCTCCCAGCG
ACACCGTCTACACTGTGGAGTACGCCATTTACGGGGATGC
GGATGAGAAGATACCCGAGCAGGTGAGATGGAGGCCGGTG
GATCAGTGCATCTCCGTCTCTCAGACTGAATGTGACGTGT
CTCAGGAGACGTTTGACCTGCGGGACGAGTACTTCGCAAG
AGTCCGCGCTACCAGCAAACACGGGCAGTCCGTCTGGAGC
GAGAGCATCGGCAGATTCAGACCACTGTCAGACACGGTTC
TGGGAGCGCCGCTGGTGGATGTGACTGTGCGGCAAAACCA
CATCGACATCACCCTGAAGGGCCCATTCAGGTGGAGGATG
AAGAGGATGAAGAAGGAGAAGTCGCTCTGGAAGATCATCC
CAAACATGATCTATAAGGTGTCCGTCTTCAACAGCAGGAG
CAATCGCACCGATGTCTTCAGGCTGACCAATGGGAGCTTG
AGTCTGGGCGAGCTGGAGTTTTCCACCCAGTTCTGTGTGG
TCGCTCAGGCCCAGTCTGAGTCTATCCCGCTGTCCTACAT
ACCCAGCCAAAAGCAGTGCGTCCACACACCCAAAGGTACC
GCCATAATCACCTTCATCAGCCCAAGAAGCATTCCTGTGC
TTTCACTTTCACATCCAACCGGTTTGATCAGTGTGAGCGA
CATGACAGGTCGAGGAAACCTTTGAATTCTTATCATCGGT
GCTGGTGTTTTCCCAGCGTGCTCTGAGCTGGACTTCCTCA
TGCCTGAGAGCTGGTTTACAGTCTTCATGTGTGTGCTGGG
TGTTAATGTGTAAACTGCTGCGCCCTGTTGCACGCAAGCC
CTCAAGCTAAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations