header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-2033
Transcript Name: il20ra-201
Previous Names: crfb8-001, il20ra-001, ch211-166e11.1-004, ottdart00000044824

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044824 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044824|OTTDARG00000032144|ZDB-GENE-040724-249 il20ra|OTTDARP00000035468 crfb8-001 LG_none BX072559.10,CU928154.6 Danio rerio protein_coding KNOWN, 2613 bp
AACACCTGAGCAGAAGAAGATGGACTTTGAGAGACGGCAG
TGTGTTGAAAACTTCTCCAGCTTCATGTAGAGCAGAAAAC
ACAGCTTAAAAAACAGAAAACCCGGCAGAATGCCAGCACT
TCAGCGATGGATGTAGTTTTATCGATCTGTCTGTGTTTTC
TCCTCAGAGCGCTGTCAGCGTCATCTGCTGATGGACCGCC
TGAGCCGCGAGACGTCCACTTCTACTCGGAGAGTTTGAGG
AACGTGGTGAAGTGGACGGCAGGACACGGATCTCCCAGCG
ACACCGTCTACACTGTGGAGTACGCCATTTACGGGGATGC
GGATGAGAAGATACCCGAGCAGGTGAGATGGAGGCCGGTG
GATCAGTGCATCTCCGTCTCTCAGACTGAATGTGACGTGT
CTCAGGAGACGTTTGACCTGCGGGACGAGTACTTCGCAAG
AGTCCGCGCTACCAGCAAACACGGGCAGTCCGTCTGGAGC
GAGAGCATCGGCAGATTCAGACCACTGTCAGACACGGTTC
TGGGAGCGCCGCTGGTGGATGTGACTGTGCGGCAAAACCA
CATCGACATCACCCTGAAGGGCCCATTCAGGTGGAGGATG
AAGAGGATGAAGAAGGAGAAGTCGCTCTGGAAGATCATCC
CAAACATGATCTATAAGGTGTCCGTCTTCAACAGCAGGAG
CAATCGCACCGATGTCTTCAGGCTGACCAATGGGAGCTTG
AGTCTGGGCGAGCTGGAGTTTTCCACCCAGTTCTGTGTGG
TCGCTCAGGCCCAGTCTGAGTCTATCCCGCTGTCCTACAT
ACCCAGCCAAAAGCAGTGCGTCCACACACCCAAAGACCCG
TTCAGAGATCAGCTGCTGGCTGCCATGCTGGGCGGTGTGC
TGCCGTCTGCCCTCTGTCTGTGTGTGATGGCTGTGCTCGG
GGCTCTCATCCGCTGCTACATCACTGACCACAGACAGAAA
CTGCCCAAGAGCACACAGCTGGTTCAACTGAGCGAAAAGC
TTCAAACGTTCAAACCAGAGGTTCCTCAGACGGTCATCTT
TAACATCAAGCTGGATGATTCCTCAGTGCTGCGTCCTGCT
CTGCCGCTGCCGTTCTCTGTTGAAGACTCTTCAGAGGAGC
CTGTGAACGCCGTCCCGCAGCCGGCCGGATCATACGCTCA
GCAGCAGCCTCTGCCCCCGGCCGGGCCCGCTTCCCTTTCA
GGAGATCTGCAGGACGGAGATTCGCTGAGTCTGGACTCTG
AGCCGCTAGCAGACCATCACAGCGAGGCTGGAGATTACGC
TTTCGTCATCCGGGCTAAGGTTGACCACAGTGAAGTCGAG
GTCAGCCAGTACAGGACACAAGGCCACACGGCAGACCCGC
AAGACCACCATATTGAAGAGGAGGCGCAGATTTTCGTGGA
CTGGAGCCCAGAGTCTGGAGAACTGAAAATCCCTCTCATG
GGTTTGCTGGGTCTGGAGGACGAGTCGGGGGTCCAGACTG
AAGCGGTTTCACTCCTGCCCAACCTGATCCTGACGCAGAC
CTCGGTGGACGGCTGCGAACAGGAGGACGATTTCAGCATG
ATGGAGCGAAACTGGGGCCTCGTAATCCACTCCAGCCCTG
AATGAACACCGTAACGCCACTGAAGCCATGTCCACACCCT
CATGAGCACTTCACAGAGTTCCCCTCATTTGCAGATTATT
TTGCTTGTTTTAAGGAAAACACTCTTATTACTGGCATATT
ATTTCTGAAAACAGGACAGTATGTTTTGCTCGTCTAGAAA
AAGCTTCTTGATTTAAGACTTTTTAGATATCTGGACTAGA
AACAAGACTAAAACTAAGTAAGAAGTGTGAGGAAATCACC
TTTACGGTGTACGAATGAGGCGATATAATGAAGGATTGTG
ATAAATAATGAAGGATTCTCAATAGACCGTTTCTGCTTGA
GCTGACTGCGAATATGAGACTCAAGCAAAGACCTTCAGCT
TCAGTATTACACATCATTTACTGAAAAAAGACGTCCAAAA
CCTGAAGCGTTCAAAGCTGCTGTGAAGCTCAGCTTCGTTG
GCTTTTAGTTGCGGAAGTGTGTTTTGACAGCAGGGGTCGC
TGTTCCAGCAGATGAAACACACAATATTTGATTGAACACC
TCTATTTTGCACAAAGAATACTGAAATATCTGTGATGGTC
AAACCTTTGCTGCTTGCTTAGAGCCATATCTCTGTGACTG
TCAGTGATTTTTCTAATGGAAATGCCCTTAATACCTTAAT
AGTGGACAAATTAATCACAGTTCATGAACATTAGAAACAC
GAGACAGCGCAACACTACTGAACAAACCTCTGTTTTTATC
CACGGATGAAGTTTAAAATGGTGTGTGTGTGTGTTGAACG
ATGTAAAAAAAATAAAGAATTAGTTTGAGTCTTGGAAGGA
GTTATTTTATACAGTGTTGTGTGTTTAAACTACACCAAAT
GCTTACTTTTATATTGAAGTATTAATGTATGTGGTTGTGA
GTGAATTATGTGGACGTTTCTGTGATGATGATTGTGAAAA
TAAGAGCTTAACTCTTTCAGCTGCAGGTTTACTTCTATTT
TAATCACTACATGTCTGTCAGTTTTTGATCCGACAAAACA
ATAAATCTTCGAA

il20ra TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA il20ra-002 (1) 1098
mRNA il20ra-201 2613
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
il20ra-201 Contained in:
[Fosmid] ZFOS-404D2 (1)
OTHER il20ra-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044824 (1)
  • Ensembl_Trans:ENSDART00000043626 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EF014958 (1) 2624bp
    GenBank:AM084416 (1) 2355bp
    CITATIONS (2)