Transcript

il20ra-201

ID
ZDB-TSCRIPT-091110-2033
Name
il20ra-201
Previous Names
  • crfb8-001
  • il20ra-001
  • ch211-166e11.1-004
  • ottdart00000044824
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044824 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044824|OTTDARG00000032144|ZDB-GENE-040724-249 il20ra|OTTDARP00000035468 crfb8-001 LG_none BX072559.10,CU928154.6 Danio rerio protein_coding KNOWN, 2613 bp
AACACCTGAGCAGAAGAAGATGGACTTTGAGAGACGGCAG
TGTGTTGAAAACTTCTCCAGCTTCATGTAGAGCAGAAAAC
ACAGCTTAAAAAACAGAAAACCCGGCAGAATGCCAGCACT
TCAGCGATGGATGTAGTTTTATCGATCTGTCTGTGTTTTC
TCCTCAGAGCGCTGTCAGCGTCATCTGCTGATGGACCGCC
TGAGCCGCGAGACGTCCACTTCTACTCGGAGAGTTTGAGG
AACGTGGTGAAGTGGACGGCAGGACACGGATCTCCCAGCG
ACACCGTCTACACTGTGGAGTACGCCATTTACGGGGATGC
GGATGAGAAGATACCCGAGCAGGTGAGATGGAGGCCGGTG
GATCAGTGCATCTCCGTCTCTCAGACTGAATGTGACGTGT
CTCAGGAGACGTTTGACCTGCGGGACGAGTACTTCGCAAG
AGTCCGCGCTACCAGCAAACACGGGCAGTCCGTCTGGAGC
GAGAGCATCGGCAGATTCAGACCACTGTCAGACACGGTTC
TGGGAGCGCCGCTGGTGGATGTGACTGTGCGGCAAAACCA
CATCGACATCACCCTGAAGGGCCCATTCAGGTGGAGGATG
AAGAGGATGAAGAAGGAGAAGTCGCTCTGGAAGATCATCC
CAAACATGATCTATAAGGTGTCCGTCTTCAACAGCAGGAG
CAATCGCACCGATGTCTTCAGGCTGACCAATGGGAGCTTG
AGTCTGGGCGAGCTGGAGTTTTCCACCCAGTTCTGTGTGG
TCGCTCAGGCCCAGTCTGAGTCTATCCCGCTGTCCTACAT
ACCCAGCCAAAAGCAGTGCGTCCACACACCCAAAGACCCG
TTCAGAGATCAGCTGCTGGCTGCCATGCTGGGCGGTGTGC
TGCCGTCTGCCCTCTGTCTGTGTGTGATGGCTGTGCTCGG
GGCTCTCATCCGCTGCTACATCACTGACCACAGACAGAAA
CTGCCCAAGAGCACACAGCTGGTTCAACTGAGCGAAAAGC
TTCAAACGTTCAAACCAGAGGTTCCTCAGACGGTCATCTT
TAACATCAAGCTGGATGATTCCTCAGTGCTGCGTCCTGCT
CTGCCGCTGCCGTTCTCTGTTGAAGACTCTTCAGAGGAGC
CTGTGAACGCCGTCCCGCAGCCGGCCGGATCATACGCTCA
GCAGCAGCCTCTGCCCCCGGCCGGGCCCGCTTCCCTTTCA
GGAGATCTGCAGGACGGAGATTCGCTGAGTCTGGACTCTG
AGCCGCTAGCAGACCATCACAGCGAGGCTGGAGATTACGC
TTTCGTCATCCGGGCTAAGGTTGACCACAGTGAAGTCGAG
GTCAGCCAGTACAGGACACAAGGCCACACGGCAGACCCGC
AAGACCACCATATTGAAGAGGAGGCGCAGATTTTCGTGGA
CTGGAGCCCAGAGTCTGGAGAACTGAAAATCCCTCTCATG
GGTTTGCTGGGTCTGGAGGACGAGTCGGGGGTCCAGACTG
AAGCGGTTTCACTCCTGCCCAACCTGATCCTGACGCAGAC
CTCGGTGGACGGCTGCGAACAGGAGGACGATTTCAGCATG
ATGGAGCGAAACTGGGGCCTCGTAATCCACTCCAGCCCTG
AATGAACACCGTAACGCCACTGAAGCCATGTCCACACCCT
CATGAGCACTTCACAGAGTTCCCCTCATTTGCAGATTATT
TTGCTTGTTTTAAGGAAAACACTCTTATTACTGGCATATT
ATTTCTGAAAACAGGACAGTATGTTTTGCTCGTCTAGAAA
AAGCTTCTTGATTTAAGACTTTTTAGATATCTGGACTAGA
AACAAGACTAAAACTAAGTAAGAAGTGTGAGGAAATCACC
TTTACGGTGTACGAATGAGGCGATATAATGAAGGATTGTG
ATAAATAATGAAGGATTCTCAATAGACCGTTTCTGCTTGA
GCTGACTGCGAATATGAGACTCAAGCAAAGACCTTCAGCT
TCAGTATTACACATCATTTACTGAAAAAAGACGTCCAAAA
CCTGAAGCGTTCAAAGCTGCTGTGAAGCTCAGCTTCGTTG
GCTTTTAGTTGCGGAAGTGTGTTTTGACAGCAGGGGTCGC
TGTTCCAGCAGATGAAACACACAATATTTGATTGAACACC
TCTATTTTGCACAAAGAATACTGAAATATCTGTGATGGTC
AAACCTTTGCTGCTTGCTTAGAGCCATATCTCTGTGACTG
TCAGTGATTTTTCTAATGGAAATGCCCTTAATACCTTAAT
AGTGGACAAATTAATCACAGTTCATGAACATTAGAAACAC
GAGACAGCGCAACACTACTGAACAAACCTCTGTTTTTATC
CACGGATGAAGTTTAAAATGGTGTGTGTGTGTGTTGAACG
ATGTAAAAAAAATAAAGAATTAGTTTGAGTCTTGGAAGGA
GTTATTTTATACAGTGTTGTGTGTTTAAACTACACCAAAT
GCTTACTTTTATATTGAAGTATTAATGTATGTGGTTGTGA
GTGAATTATGTGGACGTTTCTGTGATGATGATTGTGAAAA
TAAGAGCTTAACTCTTTCAGCTGCAGGTTTACTTCTATTT
TAATCACTACATGTCTGTCAGTTTTTGATCCGACAAAACA
ATAAATCTTCGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations