Transcript

setd1ba-201

ID
ZDB-TSCRIPT-091110-47
Name
setd1ba-201
Previous Names
  • dkey-38k9.3-001
  • setd1ba-001
  • ottdart00000030995
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030995 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030995|OTTDARG00000023719|ZDB-GENE-050309-289 setd1ba|OTTDARP00000025208 setd1ba-001 LG_ BX005309.14 Danio rerio protein_coding KNOWN, 5953 bp
ATTCAACGCGGACCCAACCTTCGTGTTTCTGCTGGAAATG
CAAGATATTCCACCTTTCTTTTCATTTCTCACATGTAACT
CAATTTGTTTGATTTATCGACGCTCGTATAAAAATTCTGC
GTTTTCTCAACGCTTCAGAATAATAATTTGAAAGCGCGTG
TCGAATGTGCTGGAAGGTTGAGATAGTGGTGTATTGTAAG
AGACAGAAACCCCAGACTAGAGGCACACAATATGTACCTG
GAGAAAGAAATAAGCTAAATGAAGATCACGGTAGAAGACA
GAGTTCAAGTTTGGCGAACGGAATGGACAACAGCCATCCT
ATCTGCAGTTCGGGAGAGAAACGAAGTCATCATTGGAGAA
GTTACAAGTTGATTATTGACCCAGCGTTGAAAAAGGGTTC
GCACAAAGTGTACCGCTACGATGGACATCAATTCAGCTCG
CCGAGCCTTGGAATGTCACCCGTGGACATCGTCCGAGATC
CGAGAATCGGTCGTCTGTGGACTAAGTACAAGGAGACTGA
TCTCCCGGTTCCTAAATTTAAGATCGACGAGTGTTACGTC
GGCCGTGTTCCCCCGAAGGAGGTCACGTTCGCCAAACTCA
ATGACAACGTCAGAGAGGGATTCCTCACCGACATGTGCAA
GAAGTTCGGCGACATCGAGGAGGTGGAAATATTGTACAAT
CCGAAGAACAAAAAACATCTCGGAATAGCTAAAGTTGTTT
TCGAAACCGTCAAGGCGGCGAAAGATGCTGTCCAGAACTT
GCACAACACGTCTGTCATGGGAAACATCATCCACGTGGAG
CTGGACCCTAAAGGTGAAAATCGCCAGAGGTACTTCCAGC
GTCTGATCAATGGAAGTTATACTCCGCTCACTCTTCCAGT
CGGTGGCGAAGAGGCCTGTGATGTTTCTCCACGCAGCTTG
GCTGAAGCCCTGATGGCTTGCGAGCCCTCCAGAAGACTGT
TCGAAGGCGGTTCGTCTGTAGTCGCAGGCACAACACCGAG
TGGCACCAACACACCCATGTCCCTGGATACAGCCTACTCC
AGCCTAAGGCAGGATACGCCCCAGTCGCAAGGCACCCCGC
ACACCCCACGCCCATCAGGCACCCCGTTCTCTCAGGACTC
CAGCTACTCCAGCAGGCAGGGCACGCCAGCGTTCCAAGCC
AACCGTGCCGAATCATCAGGAGGCTACAAATCGAGGAGAC
ATGAAACCAAATTCCAGGATGCCTACAACCGTAGACCAGA
AAGGCGATATGTCCATGGACCCACGCAACGTGGTAACACA
GAACAGCCGCCTAGTTTTAAGCAGCATCAACCACCTGAGC
CGCCATCGCCTGCATTCACGCACACGCCGCCGCCACCTAC
CAGTGCAAATTTTAAAACTGCTTATTCCCAATATCAACCC
CCAATTCCCCAAGAGTACACAGTAGCCTCCTACCACCAGC
CTGTTCAGCGGGAATTGGATTACAGAAGACCACCTCAAGC
TCCGCCTCCCCCAAGCACTGACTTCCTGCCTGTCAGAGAC
AGACCCACAACTCCACCAATCCCTGAGCCTCCTCCTGCTC
CAGAGACCCAACCAACGACACCTCCGTCTTCCACACCAGA
GCCCTGTCCATCGCCTACCCAAGAGTCTGAGCGTAACAGC
CTAGACTCCCGTATAGAAATGCTCCTGAAGCCCTTCCTGA
ATGAACGCGGAGACTCGGATGCTGAGGTGCGGATGGATGG
GAGCCCGATCTCCTCCTCGTCATCCCAGCTGTCCCCAATC
CCACCCCAGCGACCCTCGCGGCCTTCAAGCACTGGTCTGG
AGGACATCAGCCCAACTCCGCTGCCTGATTCAGAAGATGA
TGAACCGATCCGTGGTACTGCTTCACTGTTGGCGAACTCA
AGGGGTATGTCACCCACCAACATGCACAGTAAAAGCTGTG
TGGGAGAACCACGGACGGCCATTGACAAAATGGACACGAG
TCATCAGTCTTCAGGTGAAGACATGGAGATATCTGACGAT
GAGATGCCTGGCACGCCGATCGCCAGCGGGGACTGTGACA
AAAACATTGTGGTCAACTCAGCATTGTCTCTAATACAGAC
CATCCCCATGCCTCCACCAGGGTTTCCCCCGCTGCCCCAT
GCGGCTGGTTTCCCCCTACCGCCGCACCACCTTCCACACC
ATTCAACCGTTTCCCACTTGCCTAGCCATCACCCGATGCT
CCACCCACTGCACTCTTATGGCATGATGCATTTTTTACCT
GTAGATCTGCTTAGCTCTTTACCACAGTTGCTCCAGATGC
CCTTTCAGATGCAGACTCAAATGCTGAGTCGCATGGCACA
GAGCCAGCATCCGTACGCTTACCCGTACCCTGCTCCCAGT
GCCAATCCTGCCGCCATGCCATTTGGGGGTCCGTATCCAC
CATTGTCAGTGGTTAGCGCTCCTGCAGACACGCTCCATGG
GCAACCATGGCCACTACCCAGCATGCCCCAATTTAACCCC
GCTGTTCCCCCACCTGGCTACGAGCCCCAGAAGGAAGACC
CGCACAAAGCCACCATAGATGGAGTGCTGATGGCTATCGT
CAAAGAGCTGAAGGCCATCATGAAGAAAGATCTCAACCGC
AAGATGGTGGAAGTGGTGGCCTTCAGGAAGTTTGATGAGT
GGTGGGACAAACAGGAGCTTTCGGCAAAGGCTACACTTAC
ACCTGTGAAAACAGGTGAGGGCAAAGACGAGGAGAAAGAA
CGGGCCAAACCCAAAGAGACAATGTCCTCGCATTTACCCT
GGAATAAGGGCGAGGGTCTGGGCTTTGAGGGAATGAGTCT
CGGCATCGGCCTGCGTGGCATTCGATTACCGTCCTTTAAG
GTTAAGAGGAAACAGCCCCCTGAACCGACATCCACCAGTG
ACAACAAAAGGGTCCGGCCATCCACACCTGTCGACGATGA
GCTGGAGGATGAAGAGTCAGAAAGAATGGGTCGCACGGAC
GGATCCAGAGTGGATCCAGCTGGTTCTTCTTCTAAACGAA
GACCAGCCAGGCCTCTGGAGCTGGACAGCGAAGGTGAGGA
GGAGGAGGAAACATCTGGTAAAGAGGAGTCGTCACTTTCA
GATCATGAAGAAGAGCCAGTGGACGATGCATCTGAAAGGT
TGTCCTCTGGCAAGGATTTGGAGGAAGAGGATGAAAAGAA
GAGCGAATCGCACTCCAGCGAGAGTGAATCGTCTGACTCA
TCAGATGATGAAGCTTCCAGCTCATCGTCCTCCAAATCTG
GTTCTGATTCCTCAGGGAGCGAGAGCTCATCTGACTATGA
ATCAAGTTCAGAGGAGGAAGAGGAAGAGGAGGAAGAAGAA
GAGCGAATAGTGGGAATGGATGATGAAGAGGATGTGGATG
CACGAACCTCAACGTCTTCATCAACTACTTCTACTTCATC
CTCTGATGAAGAGGAGGTTGTTGAGGTAAAAGCCCCCAGT
ACCCCCACAGGACCACCCCCAGAAGAGGAACCCAATGAGC
TAGGCAGACTGGAGGCTGTAGATGAAGCAGAGATCGATCA
CAAACCTAGTATGGTGAGCTTAATCAAGACAAAAGTTGAG
GAGGTGCGACCCCCTTCACCCAAAGGATTGCCAGCTGACG
AACTAGACGTTGATCTGGAGGTGAAAATTCCAGTGCCCAA
AACTGAAGCCAGTCTGGAGGAAGTTGGTAACTTGCGTCCA
CCAACCCCAACAGGTTCGTTTGCAGATAGTGATCAGGACA
CCCGACCAAAGATCCCCACAGAAGACTTCCCTAGAACCCC
TGGTCATGAAGGCCCAGTTCCCCTAGAATCAGAGACCACA
GTCCCTCGATCTCTTCCTACACCCTCCATGCACCTTCCAC
TTCCTCCAAGTCACGTTCCTGATCCACAATCCCTTCTTCC
ACCCCCTGAAACTTTGCCGGATATGCCTGTGCGTGGGCGC
TTGCCTACAGAAGAGGACATCCCGCGAACACCCGGTAGAG
ACCTCATGGATAGAGCTCGAGGTTTGGGCAAGTTGCAGAG
CACTGATACGGTTCCTGTCACACCAGGTAGTGACACTCCT
CTAACAGGTAACAGCTTGAGTTCGCCACATATTCTCGGCA
GCCCTTTCTCTTACCCCGCTCAATCCCCTGTGCTCAGTGC
TGGCATTCCTCGGACTCCAGGTCGAGACCTTACTTTTGCT
CCAGCTTTCCCTGACTCTGCTGGTTTATCTGCAGGCCTTC
CTATTCACAGGAAGGCCTCGTCTGAGATCTTGGAGGAGAA
GCCTCTCTTTAAAGAGCCTCTACTCAGTGCCTCTCCCCAG
GCCAGCCTACCTAATAATGCTGCTTCTTCCCCATTCCCTG
GTCCTCCCCTTCCTACTGCTTCACTTCCGGAGCCTGCTTT
GCCTCCCCAAGGCTCTCCTCCTGCTTCAATAGAGAATTCC
TTTCCCGCTTCTCCAAAAGAACTTCCTGTTCCAATGATAG
ATGTTCCTGTGCCCTTAGATGATACTCCGTCAAAGAAGAA
ACTGGTACGCTCTAAGAATAAAAAAGGGATTCAAGATTCT
GAAGAGCCTCAAGTTACTTTAATAGAGGCCTCTTCACTTC
CAGAGCTCCCAGTCAATAACCAATACCCAGACCTTCCTTC
AGAATCCATCAAAGAAGAAGATGGTGAATCCGCAGTCTCT
GAGAAAGAAGAAAGCCAAGTGCCGACGATCATACCCAAGG
TTGAGGAGACGTCTTTTTATGTTGAGGAACCAATTCAGAA
GACGCGGCGACAGAGACGGGGCTGGCAGGAGTTGTTGTTG
TCTATGCACTCGCCTGTCGCTTCACCACGCCGTCCCAGCT
TCATGCCCCGCTCTGACTTCGAGGAGATGACCATATTGTA
TGACATCTGGAATGATGGCATTGACGAGGAGGACATCCGA
TACCTTAAGATCACCTACGACAAAATGCTTCAGCAAGATA
ATGCCCATGACTGGCTCAACGACACCCTCTGGGTCCACCA
TCCTCCTACCAACATGGGCAGTGCAACAGGGGTGAAGAAG
AAGCGGAAAGAAGATGGTATACGTGATCATGTCACGGGCT
GCGCCCGCAGCGAGGGTTACTACAAAATCGACAAGAAAGA
CAAAATGAAATACCTGAACAGCTCACGCTTGCAGTCTGAA
GAGCCGGATGTGGACACTCAGGGAAAGAGTATACCAGCGC
AGCCCCAAGTGTCCACCAGAGCAGGTTCAGAGCGGCGGTC
CGAACAGCGGCGCTTGCTGTCGTCCTTCAGCTGTGACAGT
GATCTCCTCAAGTTCAACCAGCTCAAGTTTCGTAAGAAGA
AGATCCGCTTCTGTAGAAGTCACATTCACGACTGGGGATT
GTTTGCCATGGAGCCTATTGCTGCTGATGAGATGGTTATT
GAATACGTTGGCCAGAATATCCGACAGGTTATTGCAGACA
TGCGAGAGAAGCGCTATGAGGACGAAGGCATCGGTAGCAG
CTACATGTTTCGTGTGGATCACGACACCATTATAGACGCA
ACCAAATGTGGCAACTTCGCTCGATTCATCAATCACAGTT
GCAATCCAAACTGTTATGCCAAGGTCATCACTGTGGAGTC
GCAGAAAAAGATCGTCATATACTCCCGGCAGCCAATCAAT
GTTAACGAGGAGATCACCTACGACTACAAGTTCCCCATCG
AGGACGAGAAGATACCGTGCCTGTGTGGTGCCGAGAACTG
CAGGGGAACGTTGAACTAACCCCAGCGGACCATAGGTGAG
AACTTAAACACGCACTGCCCCACAACAAGCCCAGACGCCA
CGTCTTCTGGAGCGACAGAGGAACGGTGGATGAAACCAAA
CGCATCCACTGGATGTATCGTGCAGCTAAGCCTCTGGGAC
TTCTTCTTCTTTTTGTACTTTTCTCATGATTGTTTACGAA
TTACAGGTGCTCTTTCAGGCATAAGAAATGAGTTTTCTAC
CACTCTTCCATTGACCTCAATAGAAACGGATTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations