Transcript

sh3kbp1-202

ID
ZDB-TSCRIPT-091110-453
Name
sh3kbp1-202
Previous Names
  • ch211-81i19.1-002
  • sh3kbp1-001
  • dkey-108d10.1-001
  • si:dkey-108d10.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044212 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044212|OTTDARG00000031735|ZDB-GENE-091204-186 sh3kbp1|OTTDARP00000035005 DKEY-108D10.1-001 LG_none CU694448.10,CR936282.7 Danio rerio protein_coding NOVEL, 2651 bp
GGCAGGCTGGAGTTCGCAAAGCGACGGAGGCAAAACTGTA
GTGAAGCGCCTTACGGCTGGGGCAACATCCACATCATCTC
TTCCCCCTCTGCATTGTTGCCCCTGCCTTTTTTGCTATTT
TTTAAACGAGGGGCAGGATAACCTTTAAGAATTATGCTTA
GTAGCCGCGTTCCTCTTTCATTTTAAGTGATTATTTGCAG
TATTCCGACCCTGGGGACCGCATCTCCCCAAAGTAGCGGA
TTTCTATCTTTTCCTATACATTGAAACATCCTCCACAAAC
ACGCCGCGCAAACAAGTTCATAAATGGTGGAAGCCATTGT
GGAGTTTGATTACCAGTCCCAGCACGATGACGAGTTGACC
ATCGCTGTCGGTGACATCATCAGTAACATCAGGAAGGATG
AGGGCGGCTGGTGGGAGGGAGAGCTGGATGGTCGGAGGGG
GCTTTTCCCCGACAACTTCGTCCGGGAGATAAAGAAAGAA
TCGAAAAAGGAGGTGAAAAAAGAGTCCAGTTTGGCCGGCT
CCAAATCAGACCTGTCCAATGGCAGCGCCAGCCCCAGATC
GGAACCAAGCCTCAGACCCGCCAAGAAAGGTGAGATGATC
CGAAAACGGCGCTGTAAAGCTGCTTTCAGCTACACTCCAC
AGAATGAAGACGAGCTGGAACTGAAGATTGGAGACGTGAT
TGATGTTCTGGGGGAGGTGGAGGAAGGATGGTGGGAAGGT
GTTCTTCGTGGCAAAACCGGGATGTTCCCCTCAAATTTCA
CCAAGGAGGTCCTGGCCGAGGTTGAGGATCTGACGCCACA
GGACGACACACGCAGCACACGAACCACTCTAAATTCTGGA
CAGACCTACAGTAACAGTCCAGCTGTGTATAAAGCTGCAT
GCAAATCCCCATGCAAATGCTCAGATCCTCCTGTGAAATG
TGTGTGTGCAGGTATAAAGGACAGCACCGGCTCAGAGAGC
GATGGCGGCGACTCCAGCAGTTTGCGCTCAGACACTGGCA
GCGTTTCCTCCAGCTCCGAGATCCAGCCCAAAAAAGTGCG
AGGCTTTGGTTTCGGGGACATTTTCAAAGACCAGCCCATC
AAACTGCGCCCGAGGTCTGTGGACATGGACAACGAGGCAG
AAAAGCCTCAGATGGTTAAGAAAGCGACTCCAGCAATTGG
CCAGGAGACCATGAAGGCGGAGCATGAGAACAAGGCCAAA
GCAAAGGAGTTTTGCAAAGTTATTTTCCCCTACGAAGCTC
AGAATGAAGATGAGCTGTCAATCAAAGAGGGAGATATTGT
TACGATTATCAATAAGGACTGCGCTGACGCTGGTTGGTGG
CTCGGAGAGCTGAACGGCAAAAAAGGAGTGTTTCCAGACA
ACTTTGTAAAGTTATTTATCCCTGAGGTAGAAAAAGAGAG
ACCTAAGAAACCACCTCCTCCTGCAGCACCAACCACTAAA
CAGATCACAGACAAAAAGACAGAGACAAAAAAGGTCCCAC
CAGAGCGGCCTGAATCTCTCCCACACAGAGCTGAAGAAAA
AGGCGAGGAGTCGAGGCTGGGTGAGATTCCAAAGCCGTCA
CTGCCAGTGGTTCTTCCGAAGAAGCCTCTTCCCCCGAAAA
ACAACAACTCGTCATTGAATCGACCGTCATCCCTGCCACC
CAAACGGCCGGACAGACCCGAGAGACCAGCTGTGCCCAAT
ATACCATGTGAGAGTCCAAAGTCTGACGGCACTGCAGACA
AATCTGTAGATGTTGATGTAGAAGACTTCGACTGCATCGT
CTTGTCCACAGAAAAGCTGAACCACCCGACCGCGTCACGG
CCCCGTGTGACGGACCGACGGCCGCGCTCGCAGACCTTCA
CATCTTCCTCTCTCTCTAGTCCTGACCTCTTGGACTCCTC
GTCTCCAGAGGAGGAGAGGAGAGACAAGGAGACGGGAAAG
GAGGAGCAGGACTCATTCACTCCCAAAACTCATGACAACT
CCAAGAAGATGCCCAAAGCAGTGCCAGTTATAACAGTTCC
TGAGAAATCATCTTTACCTCCTAAGCCCAGCGGTGTATCA
TCTTCATCGTCATCGTCATCTCTCCACCAGGGCGGCGCTG
GACTGCGGCCTCATTCGCCTTCAGTTGATGCCAGAGGGAA
GAGCGAACAGGGTCCCGTCACGCTGGAGGAGCTCAGAGCA
CAACTACGAGACCTGAAAGGAACTGTAGAGCTCATGAAGA
GCCAGCACAAACAAGAAATCAAACAGCTGGTGAGTGAACT
GGATGAGGAGAAGAGGATTCGTATATCACTGCAGATGGAA
GTGGAGCAGATTAAGAAGTCTCTCTCCAAATGAACTCCAG
CATGCAGGATGTGTAAGATGAAGGATGTGTCGAGGCTGAA
GTAGATTGTGCCAAAAAAAGAACAAAAATGTATCAGAACA
ACTGCTTAAAACAACTGTTTACCCCCGTTTCTCTTCTACT
CTTTCTGCTTTTTTTTAGTTTGTTTGTTTTTCTGCTATTT
ACTCAGACTCACAGACCCGTCGCCCCGGGTCTGGCCTTAC
TGTGGGTCATCATATGGTTAAAGGGTTTGGTTAGCTGGTC
ACCTGCACATCTGTGACTAGTTAACCATCATCCATCACAC
TCTGGTACTGAACACATCAAATGAAGGAGAAACCGTGGCG
TTTTACTTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations