Transcript

lmo2-201

ID
ZDB-TSCRIPT-091110-2122
Name
lmo2-201
Previous Names
  • lmo2-001
  • lmo2_2-001
  • ottdart00000045320
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045320 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045320|OTTDARG00000032442|ZDB-GENE-980526-419 lmo2|OTTDARP00000035815 lmo2-001 LG_ CT025900.11 Danio rerio protein_coding KNOWN, 1805 bp
TCATTGTCGAGCCGTCGTGAGCAGGAAGTCGGAAAAGAGC
AGAAACTGAGGGGGCAGGGCCATTTAAAAATACCTGCTGC
CCTACAATAACGGGACACAGAGACAGCAGCCCTGCGGGAC
ACTGGCGTGGCGACTTGCAGCGCAAAATGCACCACAAACA
AGACGGAGCCTAAACGCCACATTTATCACGCGCCGGAGAA
ATTGAACAACGCCACTGTCTGTCACCTCACATTATTCAGA
CAGAACATAGGACTGAATGCGTGGTGACAGAAATCTAATG
TAAATGAAGGATGCTTGGAATCTGGCGTACACAATGTGTG
CTGGATGTTTCTGACCTTTGATACACTTGCTAAGACAGCA
GAACAGGTGCATCTCTGAAGCGTTTTGTGCGGCAGATGGT
CTTTCGGAACCGCAGAGGGCGAGTACGGGACATATTTGGC
TTAAAAGGCGTGCATACCAAATGTGCTGAATTATACCTGA
ATCATATTGAAAATGGCTTCTACAATTGAACGGAAAACAC
TGGAGGCAAATGAGGAGCCGGTGGATGAGGTGCTCCAGAT
GCCGCCGTCACTGCTGACCTGTGGCGGGTGTCAGCAGAGC
ATCGGAGACCGCTTCTTTCTGAAGGCCATCGAGCAGTACT
GGCACGAGGACTGTCTGAGCTGTGACCTCTGCGGCTGCCG
CTTAGGGGAGGTGGGACGCAGGCTTTACTACAAACTCGGC
AGAAAGCTGTGCAGGAGAGATTACCTCAGACTGTTTGGTC
AGGACGGACTCTGTGCTTCCTGTGAAAAGAGGATCCGGGC
CTTTGAAATGACCATGCGTGTGCGTGACAAAGTCTATCAC
CTCGAATGCTTCAAATGTGCTGCCTGTCAGAAACACTTCT
GTGTTGGAGATCGTTACCTGCTCATCAACTCGGACATTGT
GTGTGAGCAGGACATTTTTGAGTGGACCAAACTCAACGGC
AGCATAGTATAGTTTTCTGCCGAAATCATAAACAAAATGT
AACCTGTCAGCATTTTCAACAAACCCTTTACTAATAGAAC
ATCAATAACAAAATATATATTTTAAAGAAATGATCTTTCT
GGCTCTATTAGCTGTGCTCTAAATGCTTGTCTCTTTTTGT
TATTTAAACTTGAGAAAAATGCCACCAGGTTTCCCAGTGT
TGGGTTGCAGCTGGAAGGGCATCCACTGCGTAAAACATAT
GCTGGATAAGTTGGCGGTTCATCCCGCTGTGGCGACCCCT
GATTTTTAAAGGGACTAAGCCGAAAAGAAAATGAATAAAT
GAATGATAATTGCCACCAGCAACATGAACCTTTTTTAAAT
TTGATGTATTTTTGCAGAACAGCGTTATACAATTTTTAAT
GTATTGCAATAAAAACTGATTCCCTTTGCTACTTTTACAC
AATTACTTCGATTTGAACTATAGTTCTATTTGTTTTGAAG
TAACACAATTGCAATAAAATGTACAGACATCTTAGAAAGA
TGATGCTTATTTTCTCAAGCTGCATTTTGTTCACTGGACA
ACTGTTTTCTGTCAATTTTTAAAAATGTATTTTATTTTTG
TGATGCAAGGCTGCATTTTCAGCAGTCTTCAATCCCATCT
TCAGTGTCATATTAGCTTTAATTGGAGCTCAAGAAACATT
TTTTCACATTATTTTTTATTGTGTGATGCTTTTTTGTGAT
GTGATATCTATAATATGTTATCAAAGTGCCAACAGAGCAC
ACCCAATATTCCTAAAAGGACATATTGTATACATTTCATA
TATATTGTGTACATATTGTATGCCAAAAAAAAAAAAAAAA
AAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations