Community Action Needed: Please respond to the NIH RFI
Transcript

ntm-003

ID
ZDB-TSCRIPT-091110-182
Name
ntm-003
Previous Names
  • ch211-222e20.5-001
  • ch73-128g7.1-003
  • ottdart00000043225
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043225 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043225|OTTDARG00000031088|ZDB-GENE-060421-6020 ntm|no_translation CH73-128G7.1-003 LG_none CR407543.6,CU464129.10,CT583725.19,CR385031.18,CT737197.8,CU467848.5 Danio rerio protein_coding KNOWN, 432 bp
ACAGACGAGGGCCAGTACATCTGTGCGGTGCAGACCAGCA
GCAGACCTCGAACCACATCCGTGCACATCATCGTTCAAGT
TCCTCCAAAGATTGTGAACCTTTCGAGGGACCTTGTGGTG
AATGAAGGCTCCAATGTCACTTTAATGTGCCTGGCTAATG
GAAAACCAGAACCTGCCATTGTCTGGAGGATGAAATCACC
TTCAGGTAAGATACAAACAGTGCCATGCCTCCTCTATTTG
CAGGTAACATTTCACACATTCTGTGAAAAAGCAAACAAAT
CTGTAGTCAACAGTTTTTGCCTTTAAAATGAAACCGCAAT
CCTCAATGTTGGTCCAGTACTGCTGATGTATGTTCCCATT
AGTGCAGTTTTTCTTTGACGATTTAGCAAAATATTGCATC
CCACTGACATAATAAATGCTGGGAAGATAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations