Community Action Needed: Please respond to the NIH RFI
Transcript

ntm-202

ID
ZDB-TSCRIPT-091110-1638
Name
ntm-202
Previous Names
  • ntm-002
  • ch73-128g7.1-002
  • dkey-109i21.1-001
  • ottdart00000043224
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043224 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043224|OTTDARG00000031088|ZDB-GENE-060421-6020 ntm|OTTDARP00000034269 CH73-128G7.1-002 LG_none CR407543.6,CU464129.10,CT583725.19,CR385031.18,CT737197.8,CU467848.5 Danio rerio protein_coding KNOWN, 1022 bp
TCAAATTGGCGTTTGCAAGAAGGAAAGAAATCACGCAGAC
CTCACGCGCTCTCGATCCGCACCAGACGCCATGAAGAATC
CCGTGTTGTGGGTCGTCCTGATTGGAATATCCATCGCTTT
GATTCAACAAGGTTTGCCCGTCCGCAGCCAAGGAGAATCT
CAGTCCGATAACAAACAGATGGACAATATCACCATCAGAC
AAGGAGAGACGCTCTTCCTCAGTTGCTCGCAAGGGGACTT
TGTGACACACACAGCATGGCTGAACAGATCGAGTATACTC
TACGCCGGAGAGGATAAGTGGTCTGTGGACCCGCGGGTGA
GTCTGGTTACTCTGAGCCAGGAGGAGTTCACCATTAAGAT
CGAGGATGTGGACGTGACAGACGAGGGCCAGTACATCTGT
GCGGTGCAGACCAGCAGCAGACCTCGAACCACATCCGTGC
ACATCATCGTTCAAGTTCCTCCAAAGATTGTGAACCTTTC
GAGGGACCTTGTGGTGAATGAAGGCTCCAATGTCACTTTA
ATGTGCCTGGCTAATGGAAAACCAGAACCTGCCATTGTCT
GGAGGATGAAATCACCTTCAGATGACAGCCTGAGCTCAGA
CAGCGAGGTTCTGGATATTCCCTTCATCAGCCGCTATCGG
GCAGGAGTGTATGAATGCACCGCAGCCAATGACATAGCTG
TGGACACACAGACGGTCGAGCTCACAGTCAACTATGCTCC
CAGTGTTTCAGATGGCAGGGATGTTGGCGTGACTCTGGGT
CAGAGAGGTGTCCTGCAGTGTGAGGCAGATGCTGTACCCG
AGGCAGATTTTGAGTGGTACAGAGATGACAGAAGGATCTT
CAATGGCTTAGATGGCATTGAGATCGAGGCTGCCGGAGCA
CTTTCAAGGCTGACTTTCTTTAACGTGTCCGAGGCAGACT
ACGGAAATTACACCTGCGTCGCCATCAATAAACTCGGGAG
CGCCAACACCAGCTTCGTGCTATACGAAATAATTGAGCCC
ACTAGTTCAACACTATTGCAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations