Transcript

kdm6bb-201

ID
ZDB-TSCRIPT-091110-1612
Name
kdm6bb-201
Previous Names
  • kdm6bb-001
  • ch73-77n15.2-001
  • ottdart00000043128
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043128 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043128|OTTDARG00000002139|ZDB-GENE-040724-166 kdm6bb|OTTDARP00000034202 CH211-237L4.7-001 LG_ AL807389.7 Danio rerio protein_coding NOVEL, 5989 bp
GGAAAAGAGAGGAGAAAGAGGGAGGAGAGAAGTGGGGAAC
AGAGGCGACAGGATTGACTCGGGAGGGAGAGGAAAGGAAT
TGCTTTGAGGGGAAAAGAAGGAAAAATAGGAGCAAGAGGG
GAAGAGAAGAGGTGAAAGTAGAGGAGAGGAGAAAAGCTTG
AACTGAAAGCGAAGGAAAGTATAGTGATCTCTGTTGAGAT
CTGCAGTGGAGGGTTTCTCAGACTCATCAGCGTGGCTGAA
TGTACCACATAGCAGAGCAGTATTCTGGACGTAACTCGTG
GGACTCCTTCCCCTCTTCTGGGCCGAATCGAGCACCATGG
GCCCCAGGCAACAACCGGCACTGGGCCCCTCCATCCAGCG
GAGGGAACTATCAATCCCCATCACAAAACTACATGGCAGG
AAGAAGCTACCCAAACAAAGCTTATAACAACAGACCTCCA
GGTTTCAGCAGGGACAGACTCCATGCTCACCCCAGAGACC
GAGGCAATGGAAAGGAGCAGAGGGTTCCTAGGAGCTGTGG
ACCAACCCAGAACCAGCACCACAACCCAGAACGCTCTACC
CTAAACTACAGCTCAGGGTATGAAGGACACCTCTCTAGCA
GTAACAATCATGGCAACCAGCCACACAGGTATGGGGGTCC
GCACCAGCAGCAGCGTTCCACTGGGCGCCCCCCACAGACC
CAGGGAGAGAAGTGGACACATTCAGCTCAATCCAGGTCTT
TCCAAGGGCCCTCTCTCAAACGTCCAGTACCTCCTCACAA
TCTCTCACAACCCCTCCGTGAACCGTCCCCTTCACGAGAT
GACTGTCCTAGCAAGAGGAGTAGGAGCATCAACTCACACC
AGAATTTCCACCCTAGAGACAAATATTTCATCAACCGTCC
ACCTCCATCTCATCCACCTCGTCCCTGGAGCCCAGCATAC
AAAAGCTCAATGTCCTGGAGCCTGTCTGAGAAGAGGTCCT
CCCCCTCCCGCTTTCAGGAGTCCAGTCATTCAGTCACAAG
AGATCACACCTATAGACCATATTCCCACTCATCACCACCC
AGCAGTGTCCCAAACCAGGGCCTCCACAACAGGAAACTCA
CCAAACAAGGGCCCGCCCATCATCCGGTCCATGATCATCC
AGACTCCCCTCCCCGCGGGGCAAAAGGGGGCTGGGATTGC
CCATCACCAGCAAACCTCACTGTGCCTTACAGTCAGCAGC
ACCAGCTCCCTCCACCACAGAGGCACACCGGCCCCTCCAG
CAGCCCAGCCACCTCAGTACCTCAACCCAGATCCAACACA
GCACAGCATGGCTGGAAAACGCAGAACCGCTCTGGAAAAC
ACAGTAACAGCGAGATGGGCCGTACAACCTATGAACTGGA
CTCCCATCAGTCTGTGGGTGGGGACAGAAAACGATCAAGC
GGATCCAAACACATTAGCCGTCAACGAAGTCCTATCCAAC
CATACAACAGTGCTGAGGGTAGAGTCAGAGATTGTACTGA
ATGGAGGAACCCAGAGACTGGGTTAAAGAAACATGACCAG
AAAGACTCAGACTCTCCTTCTGAGCCTACCACTCAAACCT
CAGAAAGAGGTCAGAGGGCACAGAGGTCAGAAATGAAGAA
AAGCAGGCACTCTAAACACCAGAATAAATTAAAATCCACC
CACAAGAGTGCCCTCAGCAAGCTGGACTCTGAACTCTTGA
AACACATTCAGGCCAAGAAGAGGCACAAGGAGCGTTTGAG
GAGGAAGCAGAAAAAGGAGGAAGGAGAACTGACAGAAGAC
ACAAAGGAACGGATAGAGAAAAAAATAGAAGAAAGGAAAA
AGAAAAAGACGAGGGAAGGAAGAAAAGGCCATGATAAGAA
AACCATACATAAAAGTGGGAGAAAGTTAGGGCAGGTTAAA
AAAAGAGCAAAAGAGGAAAGAAAACAAGGAGACAGAAAAA
GTGAGACATCCATTTCAAAAACAGCATCTCCTAATTTGGG
AACTTTGTATCCCAGTGATTCTGATCCTCTCTTGGATGAC
CTGCTGGCTGATCCACTTCATCTCAGTTACATAGAGGAAG
AGAACGAGTTCTCTCAACATACCTCAGGGTTCATCCTACC
TTGTAAATCTCCTGTCAACAATAACCATTGTTCTCCATGC
CAATCAACCCTTGAAATCAATACTAAAGTCTTGGAGGTTG
ATGAAAAGTCAGATTCTGAGCCTGACCATGTAGACACTAG
CGATGATGACAGTGTAGGAACCCATGATGTTAGTGGATCC
AATCCCTCTCTTCTTAATACACATGTCTCTGAAGAAGAAC
CCATCAGATGCAAGGAGGTTGTCCCAGGGTTGCATACTGC
TCCAGACCTCCTACCGGCTCACTGCACCTATAGCGAGGAA
CTCCTAAGGTTGGACCCACCTACAAGCCCACCTGTTTTAA
GCTGGCAGGGTTCTCCTGTTTTAGACTTGGGTGATGATGA
TGAGGATGTGAAAGAAGAAGATATGATTGGAGTGTTGAGA
AGGCCAGTGCTTCAACCTAGTCCCACACACTCATCTCCAC
TTAGAGAAGCAATTGAAATCAGCACTGGGGTTGATTATTG
CCACAGTGACCTGGCCAAGTTGTATGGACTTCCTGAGTCC
TCTAAAGCAATGGACACTGAGGAGGAGGATGAAGAAAAGA
CAGATGGGGAGCAAAAAGATGGTAGTCCTGATGCATCAGG
AAGTTCTGAGACCAACAAACCACATTTGCACCAAATGGAC
ACATTCAAATCTCCATCCTCAGCAATGGCCAGCCATAGAT
ATACTTATAGGGGTGGGCCATTTGGTCGGCCACCCCCTAG
TGCTTTAGTTGGGGTCAAATACTCCTCATCTCTGTCCTTG
GGTCCTGAGATCCACCCACCAGACCAGCAGAGTCCACCTG
CCTCATCCCCAACCACAGAGATTCCAGATCAGGTTATACA
TTCGCTGATCCAGCCCACAGACAAGGACAAAGAAAGTGAA
ACAGAAGAAGAAATAATGAAAACTGGGGCAAAAGAGGACA
AAATAGAAGTAAAAGGAGAGGAAACTAAGGTACAGAAGAT
GGATGAACAAATGGAGGTAAAATTAGCCGAACCAACTAAA
GACCCAGCCAGCACATCACTGGAAGAGAAAGAATCTGTGA
TGTCTCCAGCCACTGTTCAAGCTAAACTTGTACACAGCTG
TGAACTACTGCTCAATCAAAACTCCAGCCCAGTGTCAAAG
GTCATGAAAGTCAGTGGATCCAAGTCTGATCAGAGAGAAA
ATGAAGGAGACAGACAGAAAGATCAGTTGAAGACTCCAAG
AAAAGCGATTAGGACCATGAAAGAAGAAGAACCTGAAACT
TGTGTTGGTAGAAGCATTAAAGCAAAACATCATAAAAAAG
GTGACAGAGGAGAGAATAAAAAGGACATAATGAAAGATAA
GGCTGAGACAAATTCTTCTTCTTTGTCTTCTGAAGATGCA
CAGAAGCAATTGGTGGAAATCAGGACCAAACAAGTTGTCC
CAGAAAACCAACAAATTGAAATCAAAGTTGGAAAAACCGA
ATCTCATAAAATTAAGAGAGAAAAAGAGACAGATGTTAAA
AAAGATGCCATAAAAGAAGACGCTATTAAGGCTGATTCAT
CCGCTACAGGATGTACATCTTGCACAACTAACCTGCAATC
CTCTAGTACTATGACTCTCTTCACCAGACCACCAATGCTG
GAGCGGGTAAATCTCCGAAATCAACACGAGCTCTCTAAAA
TTCCCTTAAAAGAACTAAAGATCTGTTTGGTCAAGATTGA
GAGCAGAGGTCGGCAGACTTTCAGAGCCTCAGAGATTGAG
GAGAAAAGCATTCCACTTGATGCCATCAACATCAGAAACA
ATGCAGCCGAGGTCATACGAGCTTGCAAAGGGGCAGACAT
CAAGAACAAGTTTCGTGAATCATACCTGCTCCCGTCGCTT
TCAGTGAAACCTGACCTGTCATGCAGGACCCCAATTCCCA
GAGATAAACTGAACCCTCCTACACCAAGCATTTATCTGGA
GAGTAAAAGGGATGCTTTCTCTCCCGTGCTCCTGCAGTTC
TGCACGGACTCTAAAAATGCAGTTACTGTAATCAGAGGAC
TGGCTGGATCCCTCCGTCTCAATCTGGGTTTGTTCTCCAC
AAAATCTCTGGTGGAAGCCAACTCTGAGCATGCAGTGGAG
GTGAGGACCCAGGTGCAGCAGCCTGCAGATGAGAACTGGA
ACCATTCAGGATCCGCCCAGACTTGGCCCTGCGAAAGTAG
CAGATCTCACACCACCATTGCTAAATACGCACAGTATCAA
GCATCCAGTTTCCAGGAGAGCCTACAAGAAGAGAAAGACA
GTGAAGATGAAGATGAGGAAGACAAATCAAAGGAAAAAAA
TGAGGCAAAATCCAACTCACAAAACAACATTGGGACAACT
TCAACCACAACCAGCTCAAAGCAGAAAGCTGTTGGGAAAA
TTATTAAATTTGGAACCAACATTGACTTATCTGACCCAAA
ACGGTGGAAGGCGCAGTTGCAGGAGCTGTTGAAGTTGCCT
GCGTTCATGCGTGTGTCCTCCACCGCAAACATGCTGAGTC
ATGTTGGCCACACTATACTGGGCATGAACACTGTTCAGCT
TTATATGAAGGTCCCTGGCAGCCGCACACCAGGACATCAG
GAAAATAATAACTTCTGTTCAGTGAATATCAATATTGGCC
CTGGTGACTGTGAATGGTTTGCTGTCCATGAACACTACTG
GAAAGCCATCAGTGACTTCTGTGAAAAGCATGGCGTGGAC
TATCTGACAGGGTCATGGTGGCCGGTTCTGGAGGACCTTT
ACCGTTCCAACATCCCTGTGTACCGCTTCATTCAGAGGCC
AGGTGACCTGGTGTGGATCAACGCTGGCACTGTGCACTGG
GTCCAGGCTGTGGGCTGGTGCAACAACATCGCCTGGAATG
TGGGCCCTTTAAATGCCTATCAATACCAGCTAGCTCTTGA
GCGCTTTGAATGGAACGAGGTCAAGAAGGTCAAATCAATC
GTCCCTATGATTCACGTGTCCTGGAACGTTGCCCGCACAA
TCAAAATCACAGACCCAAACACATTCAAGATGATCAAACA
TTGTCTCATGCAGTCCATCAAACACATTCAGATCTTGAGG
GACCAGCTGGTGTCTGCAGGGAAGAAGATCTCCTATCAGA
GTAGGGTGAAGGATGAACCGGCGTATTACTGCAATGAGTG
TGATTTGGAGGTGTTTGACCTGCTGTTTGTGACTAGTGAG
AACAGCAGTAGGAAAACATATGTGGTTCACTGTGAGGACT
GCGCTCGGGAACGAAGCCCCGGTCTGAACGGGGTGGTGGT
GCTGGAGCAGTACCGCATCGATGAGCTGATGAACATGTAT
GATAACTTTACCCTGTCTGCAGTTCCATGCTGTAGGTGAG
CTTGATGTCTGAAATTACACAGCCATAACCAAATCTCCCA
CCCTCCTGCCCCAAAGCAGCGGCACAAACCTTCTGTTCTC
CTTTATTTTATTTTCATTTCCTACCAAAACCACTACTGCA
GACTTACGGAACAGCAGATCAAACCGCTGTTTACTTCACA
TTGTTTACAATCCTATCAGCAGATGTCGTCTTCCCTCAGC
CAGAAACTGACGGGACATCTGAGTCTAGAAAGACTAGAGT
GGTGCTACATCATTGGACTCGAACAATAATCTTGTAACTT
GGCTATCAGGTCACTCATCCACAACGGATAACTGCTGTGA
TTTTCCTTTTTAAAATGAAAAAAATGGAGAAAAAAAAAAC
AATTGTCAACTTGCCGAACACGTGCATTAATTCAGGTACT
GATGTAGTTTACTTTTTTATGCAAACGGAAGACGATTTCA
CCAGTCCAGTTATACTCTATGTCTCTGGTTTATCTGAGTG
GTGCTTTGATACAACGTATATAAAAACAGCAGGGGATTCA
TTTCTCTTGGCGCTGATGACCATTGCAGTGGCATTACATT
TATTCTTAGTTTGTTTCGTTTTGTTTTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations