Transcript

tcf7l1a-203

ID
ZDB-TSCRIPT-091110-1538
Name
tcf7l1a-203
Previous Names
  • dkey-27b3.9-001
  • tcf7l1a-001
  • ottdart00000042864
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042864 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042864|OTTDARG00000030852|ZDB-GENE-980605-30 tcf7l1a|OTTDARP00000034028 tcf7l1a-001 LG_ CU467905.10 Danio rerio protein_coding KNOWN, 1803 bp
TATCTCCAAATGAAATGGCCTCTTCTTGACGTTCCTGCCT
CGGCGGCTCTTAAAGACTCCAGATCTCCCACACCAGGACA
CTTGTCAAATAAGGTTCCAGTGGTACAACACCCCCATCAC
GTTCATCCGCTCACACCGCTGATCACCTACAGCAATGAAC
ACTTCTCTCCAGGGACGCCTCCTTCTCACCTCTCGCCGGA
GATTCTTGACCCAAAGACTGGCATACCAAGGACCCCTCAC
CCCTCAGAGCTGTCCCCATATTACCCTCTCTCTCCTGGGG
CAGTCGGACAGATCCCTCACCCTCTTGGATGGTTGGTTCC
TCAGCAAGGCCAGCATATGTACTCCATCCCTCCCGGAGGC
TTCAGACACCCCTACCCTGCACTCGCCATGAACGCCTCCA
TGTCTAGTCTGGTCTCCAGCCGTTTCTCTCCACACATGGT
TCCTCATCCTCCTCACGGCCTCCACCAGACGGGCATCCCT
CACCCCGCCATTGTGTCGCCTGCCATCAAACAGGAGCCCA
ATGGCGAGAGCCCCAGCAACTCCACACACGGAAAGCCCTC
GGTGCCCGTGAAGAAAGAGGAAGAGAAAAAGCCTCACATC
AAGAAGCCTCTTAATGCCTTCATGCTCTACATGAAGGAAA
TGAGGGCCAAAGTAGTGGCTGAGTGTACCCTGAAAGAGAG
CGCCGCCATCAACCAGATCCTGGGCAGAAGGTGGCACTCT
CTCTCGCGTGAGGAGCAGGCCAAATACTATGAACTGGCCA
GGAAAGAGCGGCAGCTGCACTCTCAGCTTTATCCCGGCTG
GTCTGCGAGAGACAACTACGGAAAGAGGAAGAAACGGAAG
AGAGACTGTAAATCTGACTCCCCATCAGAGAGTAACTTCT
CTCCTCAACCCAAGAAGCAGTGCGTCCCGTATCTGTCATC
TGAGAAAATGTGTGACAGCCCTACCTCGTCTCACGGCAGC
ATGCTGGACTCCCCCGCCACACCCTCCGCCGCCCTGGCGT
CCCCCGCGGCTCCAGCGGCCACACACTCAGAGCAGGCGCA
GCCCCTGTCCCTCACCACCAAACCCGAAGGCCGAGCTCAT
CATAACCACCCACACTTCCCTCTGCCAGGCAAATCCTCGG
GCTCCGGCTCAGGCTCCAGCATGGCCCTCCACAGCCTCTC
GCGCCCCATCCCCTTCACCAGCCTGCCCCCGTCTCTGCTC
GGCCCGAACTCGCCGTTCCACCAGGCCGCTCTGCATTCCC
ATCATGCTTTGCTGCAAACACAACCGCTCTCCCTCGTCAC
CAAATCTGTGGAGTGAACAGACAAAAAAAAAAATAAAGCG
ACTTTTTTTACACCTGTATATTGCTTTGTTTTTTTACCTT
TTGATAGATCATAGGCCGAGTTTTTAAAGATAGAATGAAA
AGTGATAATTATTGGTCAATATTTGACCCCCCTTCTATTT
TGCTTTTCTCTTTTGAAACCAACGACAATGTATTTTTTTG
TAAATTGACTTTTTTTTCTCTCTCCTCATGTGATTCTCCA
TTGTTGCTCCCTGTATAAAAGACAAATGTATAAAGGTTTT
CTGTTTGTTTAATTGTTTTTTAACCGTACTTGACAAATAC
AGTTTGTAGTTTTAGTTCAATTCAATCTAACGGTAGTTTA
GGAGTTCGGTTAATTTTTTTTTCATTACAGCTTTCTCTCT
TTGTTTTTTCTATTATTTTATTTTTCTCCTTCATTCTTTT
GGTACCACCTCACCCTGTTCCTAACCCTGTGTGTGTGACT
CTCCTAAGGCTCCATAGCTAATAAACCTCAAGTTATTTCT
AAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations