Transcript

slc2a1b-201

ID
ZDB-TSCRIPT-091110-1018
Name
slc2a1b-201
Previous Names
  • dkey-222k23.4-001
  • dkey-92f12.1-001
  • slc2a1b-001
  • ottdart00000043591
  • si:dkey-92f12.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043591 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043591|OTTDARG00000031305|ZDB-GENE-090915-1 slc2a1b|OTTDARP00000034560 slc2a1b-001 LG_none CR788236.7,CU929331.4 Danio rerio protein_coding KNOWN, 1823 bp
TAATTGAAACACTCCAGTTAAGAAAAAGGAGAAAAAATCA
ACTTATTTAGGAAAAGGGGAGTTGTCAGAAGAAGTTTGTG
AGAGGCATCTGAAGGCATTTACGCGGTCTCCCTTTACAAC
ACCATACTTGGCGAACTGTATTATTTATTTATTTATTTAA
GAAATAGTTGTATTAATTTCATTTAAAGTCGAATTCCGAG
GAAATCCAAGTGGGGAAAGGCGAAGTTTCTGCCGAGTTAA
CGTGCGCCGAGACGTCATTGAAATTTTGACAAGACGTGAT
GGAAGGCGGAAAGCAATTGACCTTGCCGTTGATGCTTGCT
GTGGGGACGGCTGTAATCGGCTCCCTTCAGTTTGGCTACA
ACACCGGTGTCATCAACGCTCCACAAAAGATCATCGAGGC
CTTCTACAATGAGACGTGGACAGCTCGACACGGGGATATG
ATCTCTAAAACCACAATGACTACCCTGTGGTCTCTGTCTG
TGGCCATCTTCTCTGTAGGTGGCATTGTTGGATCCTTCTC
CGTCGGGCTGTTTGTCAACCGATTTGGAAGGAGAAACTCG
ATGCTCATGGCTAATGTTCTAGCTTTCATTGCTGCAGCAT
TGATGGGCTTCTCTAAGATGGCAGCGTCCTGGGAGATGCT
CATTATTGGACGGTTTGTGGTGGGCCTTTATTCTGGTCTG
TCCACTGGGTTTGTGCCTATGTATGTGGGTGAAGTAGCCC
CTACAGCCCTCAGAGGAGCCCTGGGCACACTTCATCAACT
TGGCATCGTTGTTGGCATCCTCATGGCACAGGTCTTCGGT
ATGGAAGCTATCATGGGAAATGCAACAATGTGGCCATTTC
TCCTGGGCTTTACCTTTATCCCAGCCCTGGTACAGTGCTG
TTTACTGCCTATATGCCCTGAGAGCCCTCGATTTCTGCTC
ATTAATCGCAACGAGGAAAGCAAAGCCAAATCTGTGCTTA
AAAAACTGCGCGGGACGACAGACGTGAGCGCAGACATGCA
AGAGATGAAAGAGGAGAGCAGACAGATGATGAGAGAGAAG
AAAGTGACCATTCCTGAACTCTTCCGCTCTCCGCTTTACC
GGCAGCCCATTGTCATAGCCATCATGCTTCAGCTGTCCCA
GCAGCTCTCTGGAATCAATGCTATATTCTACTACTCTACA
AAGATCTTTGAGAAGGCAGGTGTGCAGCAGCCAGTTTACG
CCACTATCGGAGCTGGAGTCGTCAACACCGCTTTCACTGT
AGTATCATTGTTTGTAGTAGAGCGTGCGGGCCGCAGATCT
TTGCACCTCTTGGGACTGCTGGGAATGGCTGGATCTGCTA
TTCTGATGACCATCGCTATTGCCTTACTGGAAAAATATGA
CTGGATGTCCTACATGAGCATTGTAGCTATCTTTGCTTTC
GTGGCCTTCTTTGAAATCGGACCCGGCCCCATCCCATGGT
TCATTGTGGCTGAGCTGTTCAGTCAAGGCCCAAGACCCTC
AGCATTTGCTGTTGCTGGATTTTCCAACTGGACAGCCAAC
TTCATCGTGGGCATGTGCTTCCAGTATGTTGAGGAGGTCT
GTGGGGCGTACGTGTTTGTCATCTTCACCGTGTTCTTACT
CTGCTTCTTCATCTTCACCTACTTCAAAGTCCCCGAGACC
AAGGGCCGGACGTTCGACGAGATCTCCGCCGGTTTCCGTC
AGGCATCAGGGGCAGAGAAACACACGCCTGAAGAGCTCAA
CAGTCTGGGGGCGGACTCTCAGCTATAAACACGCCCCCTC
TGGCCCCGCCCACTCCTGCATACAACTACTGAGCTGAAGG
GGCCTGTCAATCAAACATTTCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations