header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9850
Transcript Name: hao2-202
Previous Name: hao2-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027286 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027286|OTTDARG00000021443|ZDB-GENE-040426-1239 hao2|OTTDARP00000022351 RP71-68N21.6-003 LG_ BX511129.15 Danio rerio protein_coding KNOWN, 602 bp
AGGCTTTTGACTGCCAACGATAGTTGGCTGAAAACACCAG
AGCAGTCCACTGTGCTGTGACCTAAATTTGTCTAAATCTA
AAAGAGAAGAAGGCGTCTGTGCAGAAATGGCTATGGTATG
TCTGGATGATTTTGAGGAATATGCGAAGCAGCACCTCTCA
AAGTCTACATGGGACTATTACGAAGCTGGAGCTGATGAAT
GTTGCACCCGAGACGACAACTTGCAGGCCTATAAAAGGAT
TCGCTTGAGGCCACGGATCTTGCGTGACGTGTCGATCAAT
GACACTCGGACCTCTGTGCTGGGACGGGAAATAAGCTTTC
CTGTTGGAATTGCACCCACAGCTTTCCACTGCCTGGCCTG
GCATGAGGGAGAACTGGCCACTGCCAGAGCTACTGAGGCG
TTGAACACATGTTATATAGCCAGCACTTACGCCACATGTT
CAGTGGAGGAGATCGCAGCAGCAGCACCCAACGGCTACCG
CTGGTTCCAGCTGTACTTGTACCGCGACCGGAAGCTTTCG
GAGCAGATTGTACACAGAGTGGAGGCTCTTGGCTATAAGG
CTCTGGTGCTTACAGTAGACGTGCCTTACACTGGCAAACG
TC

hao2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hao2-201 (1)    Ensembl 1795
hao2-202 602
hao2-203 (1)    Ensembl 773
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hao2-202 Contained in:
[BAC] RP71-68N21 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000027286 (1),  Ensembl_Trans:ENSDART00000133903 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB838247 (1) 607 bp
CITATIONS (2)