ZFIN ID: ZDB-TSCRIPT-090929-9848
Transcript Name: hao2-201
Previous Name: hao2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027284 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027284|OTTDARG00000021443|ZDB-GENE-040426-1239 hao2|OTTDARP00000022349 RP71-68N21.6-001 LG_ BX511129.15 Danio rerio protein_coding KNOWN, 1795 bp
AAAGAAGTAACTTATTGAGCACATCGGCCGGAAACAACTA
ATCAACGTGCGGATGCCACAATCAAAGGCTAGTTCATGTG
TGAACTAAACTGTGGTTGATGGTTGCAGAGTTAAAGAGTC
AAAATAGAGAAGAAGGCGTCTGTGCAGAAATGGCTATGGT
ATGTCTGGATGATTTTGAGGAATATGCGAAGCAGCACCTC
TCAAAGTCTACATGGGACTATTACGAAGCTGGAGCTGATG
AATGTTGCACCCGAGACGACAACTTGCAGGCCTATAAAAG
GATTCGCTTGAGGCCACGGATCTTGCGTGACGTGTCGATC
AATGACACTCGGACCTCTGTGCTGGGACGGGAAATAAGCT
TTCCTGTTGGAATTGCACCCACAGCTTTCCACTGCCTGGC
CTGGCATGAGGGAGAACTGGCCACTGCCAGAGCTACTGAG
GCGTTGAACACATGTTATATAGCCAGCACTTACGCCACAT
GTTCAGTGGAGGAGATCGCAGCAGCAGCACCCAACGGCTA
CCGCTGGTTCCAGCTGTACTTGTACCGCGACCGGAAGCTT
TCGGAGCAGATTGTACACAGAGTGGAGGCTCTTGGCTATA
AGGCTCTGGTGCTTACAGTAGACGTGCCTTACACTGGCAA
ACGTCGCAATGATATACGCAACCAGTTCAAGCTACCACCA
CACCTGAAGGTCAAGAACTTTGAGGGGATGTTCCAGGAGC
AAACAGAAGCCCAGGAGGAATACGGGATCCCAGCTAATAC
TCTGGACCCATCGATCAGCTGGAAGGATGTTTGCTGGCTC
CAGTCTCTGACACGGCTGCCTATTATTATCAAGGGCATCC
TCACTAAAGAGGACGCAGAGCTGGCTGTAGAGCATGGCGT
CCAGGGCATAATTGTGTCTAATCATGGTGGCCGGCAACTG
GATGGAGGGCCAGCAACGATAGATTGTCTGCCTGAGATAG
TGGACACAGTGCAGGGCCGGGTCGAGGTCTACATGGACGG
AGGGATCCGTACAGGCAATGACGTGCTGAAGGCCATAGCC
TTGGGAGCCAGATGTGTGTTTATTGGCAGGCCGGCAATCT
GGGGCCTCGCTTACAAGGGGGAGGATGGAGTGAAAGAAAT
CTTAAATATTCTACATGATGAGTTTCGCTTATCCATGGTG
TTGGCAGGCTGCAGAAATGTTGCTGAGATCAACAGGAACC
TCATTCAGTTCTCCAGACTTTGAGAAGCAAAATGGACTAT
AATAATTTCTACTTTAACACTACAAAGATCCATATACTAT
TACTAAATGTACACAAGAAAACTCTGTTGCTTTTAGTCGC
AAGAATAGCATATCTACAATTGTTAACAGTGTATTGATGG
TTTTAATACTTGTTTTTCAGTAAGCATCAAGAACAGAACC
GGGAAATCCCCACACTATTTTTATTGAGAGAATCAAGAGT
GAATTATCTTAAAACCTTCACTCATTACAGATTGCTTCAA
ATCAGCTTCACAACAGTAAATAACAAAATAGAATTGGTAT
TAGGTACAATTTAATTCATGATTATGAATAAATCACTTCT
AATTTATCTATAAAGCAGCCATACACAAGATAAAAGTTTG
ATCAAGGCATATGCTAAAAGAAAAGCTTCTTATTAATAAG
CTAAGTGATCGGTTTTAATAAATACTGAACATCCAGTTAA
TATTTGGTCAAAATAACAAGTGTGGCAAAATTAAACAACA
TGTAATTCTTTAACTGACTGTGTGTTAATATTTTAAGTTA
TATTATTTACTTTACAATAAATACTACGCTCTTTC

hao2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hao2-201 1795
hao2-202 (1)    Ensembl 602
hao2-203 (1)    Ensembl 773
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hao2-201 Contained in:
[BAC] RP71-68N21 (1)

Genome Resources: Vega_Trans:OTTDART00000027284 (1),  Ensembl_Trans:ENSDART00000035428 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC055205 (1) 1809 bp
CITATIONS (2)