Transcript

bcl2a-201

ID
ZDB-TSCRIPT-090929-9726
Name
bcl2a-201
Previous Names
  • bcl2-001
  • bcl2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027147 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027147|OTTDARG00000021372|ZDB-GENE-051012-1 bcl2a|OTTDARP00000022244 bcl2-001 LG_none CR394529.7,CU695001.5 Danio rerio protein_coding KNOWN, 1828 bp
GTAAGGAAGCCCGCCCCCTCGCAGAGAGTGCTCTTCAAAC
AGCTTCAGTTACAACAGTTTCTGACTGAGCGTCGCTTCAA
TGAACGCGCCAGCCTCGATGTCATTCGTCGGCGGTGACGG
AGCACGCGTAAATTCTGCACGATCCGCACCGCGCGTTGGA
GAAACTGCGTTTTGCCAAAACAGCATGGAAATATACTTGT
CCATCTGACACGAGGAAAAGTGCTTCGTGCGCTGACTTGG
TTGCTATTTTCTCTTCCGTCTTTTCTGGGACCTCGAATGT
CAGTGGAATATTTAGAAATACTGCGTTTGCTTTTACTCTC
TCCTTCAGTCCTGTAACGTCAACGACGTACGGTGTTTTTT
GTATGTGAGTGCGCTTTTGGGTGGATATCCAGTGGAGTGT
AATAGAAAAGCGCAGTGAGTTTGAGCAGTGAAGGGTCATT
CCTCGCGCCGCGCTCGCGCACTGCAGCAACCGCCAATTCA
TCCATCAATCGGCGCGCTCTGGACGTGAGGGTTTGCAGCC
AGTTCTGGATATAAAGTTAAAAACTAACATTTTAACGAGT
CGCAACCAATGAATGTGATGCTAAATTATAACATTTGCCT
CAGATATTGCATTTTAATGACAGAATTCACATCAGCGCGA
TGTGAATTTGACATTTTCCCCAGCTTTTCTCGTTGAGAGA
CCGTTTTTCCGTTACCATGCACTTCGAATAACCGACTCTT
TCCTGCTCGCGCGCGTTTCTATCGTGATTTAAAACCATGG
CTAACGAAATTAGCTATGACAATCGGAATATTGTGGAGAA
ATACCTCAAGCATAAACTTTCAAAGCGAGGATATGTGTGG
AAATGTCAGTCCTCTGCTGAGGAAGATGACACCTTCAATA
AAGCAGTGGAGGAATCCTCTCCAAACTCTGACAGGAGGCT
TCAGGCTCCCTCAGCCGGCGGAGGGAACAACTCTGAATGC
CTGATAGCCCGGGTCACTCGTTCAGACCCTCATTTGAGGC
TCTACCGGGTGTTACGGGATGCTGGAGATGAAATAGAAAG
GATTTACCAACGCGAATTTGAGGAAATGTCCCAACAAATG
GTGTTCAACCCAAATTCTGCGCAACGCAGCTTTCTAACCG
TGGCCGAAGAGCTCTTTAGAGACGGAGTGAACTGGGGGCG
GATCATTGCATTCTTCGAGTTTGGTGGGACCATGTGCGTG
GAAAGCGTCAACCGGGAGATGGCGTCCCAGGTAGATAATA
TTGCACACTGGATGACTGACTACCTGAACGGGCCACTGGA
AAACTGGATCGAGGAAAATGGAGGTTGGGATGCCTTCGTG
GAGATGTACGGTCAGCAGAGAGACTCTGTGTTCCACCCGT
TTTCATACCTAACAAAAGTGCTCGGCTTGGCGGCGCTGGG
CTTGGCAGGAGTGACCATCGGAGCCTTTTTTGCTCAGAAG
TGACAGCCTCTGCGGTCTCCATGCCAATCTATTTCACTTT
CTCTGCCTGTCTCTCCTCTTCAGCTTATCAAAGCATCTTT
CAGCGCTGCACTGCCCCGCTAAGCTCGGCTCCAGTGCCCT
TCAAAGGCCGCCGCTGATCCGATGGCCCTCCAGCCGCGGG
AGCAGCGGCGCTCATGCTCTATCACCCTCTCTGGAGTGAA
GAAACGCAAAGAAAAAGAATACAGAATGAGGACTCGCAGG
AGCGCTGCCACACTTTTGACTGTGATGCTCGTCACTGCCA
TGTACAGTTGCACTCGCACAGAGATCGACACACAAAACAC
GTGCACACATGCTCACATTCTTCATATGGATGCAAAAATA
CAAAAAAAAAAAAACTTTTATCTTCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations