Transcript

myo3a-202

ID
ZDB-TSCRIPT-090929-9675
Name
myo3a-202
Previous Names
  • myo3a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027091 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027091|OTTDARG00000021331|ZDB-GENE-041026-4 myo3a|OTTDARP00000022205 myo3a-001 LG_ BX530066.21 Danio rerio protein_coding KNOWN, 7376 bp
CAAGTGTTCACACGCCACGACTGCCTCAACGGAGTCAATA
TGGACTTATTCAACAAAATGTTCAGCAATTATTTGAGGAA
AGAGTGAGATCACTCGGGAAGATGTTTCCTCGCTCAGGGA
AATCCATCATCTTTGACAGCTTCCCAGATCCGTCTGACAC
CTGGGAGATCATTGAGACTATTGGCAAAGGGACTTATGGG
AAAGTTTACAAAGTGCATAATAAGGTCGATGGCAGCAAAG
CCGCAGTCAAAATACTGGATCCAATCCATGACATCGATGA
AGAAATTGAAGCTGAGTATAACATCCTGAAAGCTCTTTCA
GACCATCCCAATGTTGTTAAATTCTTTGGGATGTTCTACA
AGAAGGATGTCAAGACTGGAGACCAGCTATGGCTAGTACT
AGAGCTGTGTAACGGAGGGTCTGTCACAGATCTGGCCAAA
GGTATGCTAAAAAGAGGAGATCGCATGGAGGAACCCATCA
TAGCCTTTATTCTACATGAAGCGCTCATGGGTCTTCAACA
TTTGCACGTCAATAAGACCATCCATCGAGACGTCAAGGGC
AACAACATCCTGCTCACCACGGACGGAGGAATCAAGCTGG
TTGACTTTGGGGTTTCAGCCCAGCTCACAAACACCCGACT
AAGGAGGAACACTTCGGTGGGAACGCCCTTCTGGATGGCT
CCTGAGGTCATCGCGTGTGAGCAGCAGCTGGACTCCACAT
ATGATGAACGCTGTGATGTTTGGTCATTGGGAATCACAGC
CATAGAGCTAGGTGATGGAGACCCGCCTCTCGCTGAACTC
CATCCAATGAGAGCTCTCTTCAAAATACCAAGAAATCCAC
CACCCACTCTACACCAGCCAGAGCTCTGGTCAAACGACTT
TAACGATTTCATACGCAAGTGTCTGATAAAGGATTTTGAG
CTCAGGCCCAATGTGCTTGACCTTCTTCAGCATGTCTTCA
TCAAACAGATTGTGGGCCGAGAGAAGACGCTGCAGAAGCA
GCTGATGGAGCTAATCGACCTCAACCAGCAAATGGGCATC
ATTGAGAAAACAAGCCTTCTCGGAAAATCTGACAGGGACA
GTGACTCCAGGCATGAGCGTATCCACACCAAGAAAAACAG
CTACATGAAGTCTCAAAGTCAAACGTGTGACGACGCTGAT
GATCTGGCAACCCTAGAGGTTCTAGATGAAAACACAATCA
CCGAACAGCTACAGAGACGTTACACAAAGGAGCAGATCTA
CACCTACGTCGGAGACATCCTTATAGCGGTCAATCCATTT
CACAAAACCGAGTTATACACACCTGAGCATACTAAGAGTT
ATGTTGGCGCCAAACGAACATCAAACCCCCCACATATATA
TGCAGTGGCAGACATTGCGTATCAGTCCATGGTGTCCTAT
AATGCAGATCAGTGTATTGTCATCAGTGGAGAAAGCGGCG
CTGGGAAAACAGAGAGTGCTCACCTGCTAGTCCAACAGCT
GACTGTCCTTGGAAAGGCCAACAATCGGACCCTCCAGGAG
AAGATTTTGCTGGTTAACAGTCTGGTCGAGGCATTCGGAA
ATGCCTGCACTGTGATCAATGATAACTCCAGTCGCTTTGG
CAAATATCTGGAGATGAAGTTCACCTGTGGTGGGACAGTA
GTGGGAGCTCAGATCTCTGATTATCTGCTGGAGAAGTCTC
GAGTCGTCCACCATGCAGTAGGGGAACGCAACTTCCACAT
CTTCTATTATATCTACGCCGGACTGGCAGAGAGGAAGAAA
CTCGGCCATTACAAGCTGTCAGACAGCAAAACTCCAAGGT
ATCTCCACAATGAGAATGTTAAATTAGTGCCTGACATTGT
GGGCAATGCCTTCTATAAGGAGCAGTTTGAGACTGTGGAG
CAGTGCTTCAAAGTCATCGGCTTCACCCTAGAGGAGCTCG
GGAGTGTTTACGGCATCTTAGCTGGGATCCTGAATACAGG
AGACGTCGAGTTCACGTCAGTGGCTTCAGAACATCAAACG
GACAAAAGCAACATTTCCAACATGGCAGTACTAGAGAGTG
CTGCATCGCTGCTGTGTATCCGTGCAGATGAGCTACAGGA
GGCTCTGACATCTCATTGTGTGGTCACTCGGGGTGAAACC
ATCGTCAGGTCAAACACAGTGGAGAAGGCCACAGAGGTGC
GGGACGCCATGGGTAAAGCCCTATATGGACGCCTGTTCAG
CTGGATTGTCAACCGCATCAACTCTCTGCTCAAACCAGAC
AACCAATCAGGGGAGGACGACAAGGGTCTGAACATCGGCA
TCCTGGACATCTTCGGCTTTGAAAACTTTAAGAGGAACTC
TTTCGAACAGCTCTGCATCAACATCGCCAATGAGCAGATC
CAGTTCTACTTCAACCAGCACATCTTCGCCTGGGAACAGG
ATGAGTATCTGAATGAAGATGTAGACGCTCGAGTAATTGA
GTATGAAGACAACCGGCCGCTGCTGGACCTGTTCCTTCAG
AAGCCCATGGGCATGTTATCGCTGCTGGACGAGGAGAGTC
GCTTTCCTCAGGCAACTGACCAGACCCTCGTCGAGAAATT
TGAGGATAACTTAAAGTCCAAAAACTTCTGGAGACCAAAG
AGGGTTGACCTGGGCTTTGGAATCCATCACTATGCAGGCA
AGGTAATCTATAATGCCGGCGGCTTCCTGGCTAAGAACAG
AGACGCTTTGCCTGCTGATATAGTTCTTCTGCTGAGGTCA
TCAGAGAATGAACTGACCCGTAAACTGGTTACGCATCCGC
TCACTAAAACAGGTAATTTGGCGCACACTAAGGGCAAAGC
TGTGGGCTCTGCTCGGATGGGCACACAACAATCACAGCGC
TTTGCCAAGTTGGATTGCCTTTTGTTGTTCAGTTCTGTAT
CATTCAGTGAGTCTTCCTCTCGGAAATTAACTCCACCCAT
TGACAAATCAATGCTTGCCTTGCCTGTTGACTCTGTACAA
ACGACGGAGAGCACTGGAGACACCACACATCACCCCAGGG
AGACCACCAACATGAAGACTCAAACTGTAGCGTCGTACTT
CAGATATTCTCTAATGGACCTGCTATCAAAGATGGTGGCA
GGCCAGCCTCATTTTGTTCGATGCATAAAACCCAACAATG
ATCGTCAAGCTCACAAGTTTGACAGGGAAAAGGTTCTGAT
CCAACTACGCTACACTGGTATTCTAGAGACGGCCAAGATC
CGCAGACAAGGCTACTCTCATCGCATTCTCTTCAACAACT
TCATCGAAAGGTACTCCATATTAGCATTTAGAGCTAATGA
AGAGCCAGCAATCAGTCCTGAGACGTGTGCGGTTATTTTA
GAGAAGGCCAAACTGGAGAACTGGATTTTGGGCAAGACAA
AGGTCTTTCTGAAGTATTATCATGTGGAGCAGCTGAATCT
GATGGTCAGGCAGACCACTGACCGGATTGTTCTAGTTCAG
GCATATGTACGGGGCTGGATGGCATTCAAGCGATACTGTT
TGCTGAAGGAAAAGAGAGAACAAAGCGCTGTGGTGTTACA
ATCAGCATACAGAGGACACAAGGCTCGGAAAAGTATAGCT
GATGACAGAAGTAAAGCAAAGTCTGAAATAGTTTTCACCC
AACTTCAAGCTTGGTGCAGAGGATATTTGGCAAGGCAGAA
TTACAAGGAGCTACTAGATGAGAAGAACAAAGCTGCTGCA
AAGATCCAGGCCCATTACAGGGGACAAAAAGAGAGGAAGA
GTTTCCAGAGGAAAAAGGAAGCCATGCAGAAGGAAAACAC
AGAGAAGACAGAAAGAGTGACAGAGGTCCCTTTAGAAGCA
GACGATCCTGTTTCAGAGGAACCGCTACAGGAAGGAGGTG
AAGTGGAAATGGATGATGCTGATGAAAAGGCAGCTGTGGT
CCTCCAGAGCAACTACCGAGGATACAGAGAAAGGAAGAAA
TTCAAGGAACGTCAGGAACGGAATAAGACCTTGAGCGGAG
ATGAGCTGGATGCTTCCTCATCCACCCCTGAAGAAATGAC
TTCTGGAGAAGATCTGGAAGCTACACGAGAGGACACGCAG
GAGAATGTTGAGAAAGAGGGGAATGAGGTTGAGGAAGGTG
GAGGAGATGAAGACCCTGAGCAGGAAGCCAAGGCAGCCAC
TGTTCTCCAGAGCAACTTCAGAGGTCATAAGGAACGTAAA
AGACTCCAAGAGGAAGGAAAGATACCAGTTAGAGGAAAGA
AGGAGATTAAGAGTCCTACAGATGAGGAGGAGCTTCCTAT
TCCAGATCCACCGCCCCCTGAGGAATTGATGGAGTTTTCA
GAGGAAATGGAATTTACTGAAGAAAATCCACCAGGAGAAG
AAGACGAGGCCAAAGCTGCTGTGGTCCTTCAGAGCAACTT
CCGTGGCCACAAAGAAAGGAAAAGACTCCAAGAGGAAGGG
AAAATCCCAAAGAAAAAGACTAAAGAGGAAATGGATGATC
CAGGAGCTTCAGAACCAGACATTGCCATTGAGGAGCTTCC
ACCGCCTCCTTTAGAACTTGAACATGATCAAGAGCTAGAC
TCTAGTCCATCAGGAGGAGATGAGGAACACGCTGCAACTG
TTTTACAAAGCAATTTCAGAGGACACCGGGAGAGAAAGAG
ACTGAGAGCTGAGAAAGAAGAGGCAACAGGAGGAGGGCAA
AGCACTGGAGATGTGGAGGAGCAGGAGAACAATGACGTTC
TAGACATTACAGATGTTCAGCTGGAACGAAGGGAAGAAGA
GGAGGAAGGACAATACGATGAGGAGCAGGCAGCCATTAAA
ATCCAGAGCAATTTTAGAGGCTATAAAGACCGAAAGAACC
TGAAAGCTACATCTCAAAAACAAGATGAGGAAGTGGAGTC
ACTCTTCAAACAGGTATCCAAGGCCTCTGAAGACTACCTT
TCCCTTCAGAAGAAGTTAAATGAAATCATCCTCGCCCATC
AGCTTAACCCCAGCAAAAATGGCATGTTTGTGAAAGGACA
ACCCATGAATGGCTACATGGGCTACTACCAGCCACCAGCT
GACACAAAGCAGTCTCGAACACCACGCCGCGCACAACAAC
CCAAGACCCTGAACACGCCGGAGGACTCCACATACTACAC
ACTTATTCATAGGTCTGTCCAGGACGATAAAAGGAGGCCG
CGGAAACAAAGCCCAAAAAAGTTGGACAACGATGACCAAT
ACTACCAGGGTTTGTCCAGCAGTAAATCCACCAGCCTTCC
CAATGAACGACGCCGGTCGAGCAAGCGGAGGGCTTCTGAT
GAAAGACGCTCCTCTGAAAGACCACTCTCTGATGTCCCCA
AATCTGAAATCCCCAAAGACCCATTGGAGAAGAGGCACTC
GTTCTCTAAAATGCCCTCTACAGAGAGTCAAAGCGAGGAC
AACCCCTACGACTACAGGAAGATACTGAGAAAGACCTCCC
AGAGACGACGACTAATAACACAGCCATAACCCCGAACATC
ATCTTCTTTGAAGACTTGTGTAAATATGTCATTTCAAACC
TATAAGACTGGCATTCTTGCATGGAACACAAAAGAAGACA
TTTGGAATAATGTACCTGCTGCTCTTTTCCATGTCATTTC
AAGCATCGAGAATAGAAGCTTTTGCTCTTCAACAAAACGG
TGCTTGATTCATCAAAGATTCATTCTTTTGAATCAGATGA
GATGATTCGTTCCCAAATCAAACTGATCCAATTGCAGCTT
ACTAAAGAGGAAGATTATCGTTTTGGGGTGATCTGTGTTT
TTTTTAAGTAATACACAGGTTTTCTGTTCACTTATTGTTA
TTATTTTTGTTGGTTTTACCAAAGAACTTTTGCATTATTA
AACAAAAACTGTAACACTCTACTTAAAGGGGTGTTCATAA
GACTACTTTAAACCTTTATAATTATGACTTGACACACGTT
AGGAATTTAAATGAGATTGTATTTATGCTTTTAACATTTA
TCATGTCTTTATACTGTAAAAAATCCTAGTTGCCTTACAT
TTTTAAGCAGAATCAAATCAACCTCATGAGTCCATTGAAC
TTATATTATGACTTAAAACAGCTTGCCTAACTTATAAAAT
TAAGTTAGAACATGATTAACTTAGTTAATAAGCTGTAATA
CCTAATAACATATGCTGTCAGGACTGATTGATCATTTCAT
TTTTTTACAGTGCAGCTCAGTTATGACGTTTTAAATGCAA
AGATGACGTTGTTTGTTATGACAACTTGACATTACCCAGA
CAACAAAACTTGTCATAAATCTGTCATAAACATGACTGTC
GGGCGAGGCAGTGGCGCAGTAGGTCGTGCTGTCCCCTCAC
AGCAAGAAGGTCGCTAGGTCGCTGGTTCGAGCCTCGGCTC
AGTTGGCGTTTTTGTGTGGAGTTTGCATGTTCTCCCTGCG
TTCGCGTGGGTTTCCTCCGCGTGCTCCGGTTTCCCCCACA
GTCCAAACACATGTAGTACAGGTGAATTGGGTAAGCTTAA
TTGTCCATAGTGTATGAGTGTGTGTGGATGTTTCCCAGAG
ATGGGTTGCTGCTGGAAGGGCATCCGCTGCGTAAAAACTT
GCTGGATAAGTTGGCGGTTCATTACGCTGTGGCGACCCCG
GATTAATAAAAGGACTAAGCTGACAAAAAAATTAATGAAT
GAATGAACATGACTGTTCTGAAGCTATAAATGTGTTATCA
ATTTTATGACAGCGTCATTAATACATTTTGTTACCTCAAC
TACAGTGACAAGTTTAAATTGTCATTAAAATTAAATTAAA
TATTCAATTAACTTAGTTAATAAGCTGCAATGACCTAATA
ACATATGCGGTCAGGACTGATTGATCATATCATTTTTTTA
CAGTGCAGCTCAGTTATGACGTTTTAAATGCAAAGATGAC
GTTGTTTGTCATTGACAACTTGACATTACCCAGACAACAA
AACTTGTCATAAATCTGTCATAAACATGAATGTCTTGAAC
CTATTATAAATGTGTCATCAATTTTTTGACAGCATCATTA
ATACATTTTCTTTACCTCAACTACAATGACAAGTTTAAAT
TGTCATTAAAACTAAATTAAATATTAGTGATGCTGTTAAA
AGTTATTTGAAATAGTAATGACACTTTTAATAAAACATTT
AGATAACTAATACAGTTTGTTCTACTGAAAACGTGGTCAG
AAAGATATTCATGACACAATTAAAATGCCTCATGACAATC
ATGTCTTATGAACAAGCCTAAAGAGCCTTAGTTTAAGTAC
GTAGTTGTGCAAATAATGAGCACTCAATACTTTATGCTGT
ACAGAATGTAACATTAGTTGATAATCAGAGTTAGCATTGT
AACAGGACATTTGAGCTGCACTTGCTTTATTTTTATCTCA
GGTTTAGCTTGTTTTCTGTATGCAAGTCTCTTTATGAATA
AAGATGTCTGTGAAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations