header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9661
Transcript Name: wdr24-201
Previous Name: wdr24-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027074 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027074|OTTDARG00000021318|ZDB-GENE-040426-2012 wdr24|OTTDARP00000022191 wdr24-001 LG_ BX322798.6 Danio rerio protein_coding KNOWN, 2986 bp
CTCCTTTCCACACACACACTGAAGGAGCGCGCCTTACGAC
GGGAGGTGACGTCAGCGGAGAACGTAAACAATGATTCTAC
ATCCGCTTCTCGTGAACGGACACATTTGTTTTGAAAAGGG
TTGATGTGAAATTCTTCATACAGATGTTAAATGCGCCTTC
GTGAATGTGTGTGTGACGTCACGCACCAGCGGCCACACAC
TGATCTCAAGTTTGCATGAGAAAACAGATGGAGAGAGAAA
ATCTGTTCAAGTCTGTGCTGCAATAACAATAATATTCCCT
GACAGGCTTGCTGTTTTACGTCAAGACTCGGTGTGGAGTA
AATGAGAAGCTTGAAGGTTATCTGAGTAGTTTCTTTCTCA
ACACAACAGGCTTTGGACACGAAGCCTTGAGATGGAGAAG
ATGACCAGGGTGAGCACCATCAATGGACGGACCATGTTCT
GCCACCTGGATGCACCTGCAAATGCCATCAGCGTCTGTCG
GGACGCCACGCAGGTGGTGGTGGCCGGCCGTAATATCTTC
AAGATCTACGGTTTAGAGGAGGACGGTTTCGTGGAGCGTC
TGAACCTGCGTGTGGGTCGCAAACCCTCACTCAACTTCAG
CTGTGCGGACGTGATGTGGCATCAGATGGAGGAGAACCTA
CTGGCCACCGCCGCCACCAACGGAGCCGTGGTCACCTGGA
ACCTGTCGAGACCCTGTCGAAACAAGCAGGAGCAGCTCTT
CACCGAACACAAGCGCACCGTCAACAAGGTCTGCTTCCAC
CCGACGGAGGTCAACATGCTGCTGTCCGGCTCGCAGGACG
GATTCATGAAGTGCTTTGACCTGCGCAAGAAAGAGAGCGT
CAGCACCTTTTCTGGTCAGTCGGAGAGCGTCAGAGATGTG
CAGTTCAGTATGAAGGATTATTTCACATTTGCAGCTTCTT
TTGAGAATGGAAATGTGCAGCTTTGGGACATTCGCAGACC
CGACCGCTATGAGAGGATGTTTACTGCACACACCGGACCT
GTTTTCTGCTGTGACTGGCATCCGGAGGACAGAGGCTGGC
TGGCGACGGGTGGCCGTGATAAGATGGTAAAGGTGTGGGA
CATGTCCACCAATCGTGTGAAGGAGATCTACTGTGTCCAG
ACCATCGCTTCGGTGGCGCGGGTCAAGTGGCGTCCGGAGC
GCCGCTATCATCTGGCCACCTGCTCCATGATGGTGGACCA
CAACATCTACGTGTGGGATGTCCGGCGGCCGTTCATCCCC
TTCGCCACTTTCGAGGAGCACAAAGACGTGACCACGGGCA
TTGTCTGGCGGCACCAGCATGACCCGTACTTCTTGCTGTC
GGGCTCCAAAGACAGCACACTGTACCAGCACATGTTCAAG
GACGCCAGCAGACCTGTCGACCGCGCCAATCCCGAGGGAC
TCTGTTTCGGGCTCTTTGGGGACCTGGCATTTGCTGCTAA
AGAGAGTCTGATGTCCGCTCCTGCTTCTGCCGGGGACGTG
GGACGTAAAACGTACCCTGGCGGTGACCGACGGTACCCCA
TCTTCTTCTTCAAGAAGCCGGATGTGACAGAGCAGTTTGC
GCAGGTGTCCAGCGCCCTCAGTGTGTTCGAGAGCGAAGCT
GACAGCAGCGCCGGCATGGACTGGTTCATCAACACTGCTC
AGAGTTACTTACTGAGCGGCAAACCCTTCGCTGAACTCTG
TGAACACAACGCTCACGTCGCCAAGAGCCTCAACAGACCA
CAGGAATCAACCACATGGACGATGCTGCGAATCATGTTTT
CTGAACCGGCCAATCCCTCCTTGTCAACCAATCATAATCT
AAACAAATCAGGAAACCTTCCACTCGTCAATAGCTTCAGT
ATGAAGGAGATGAGTGGTGCTCTTAATGAGAGAAACAAAG
AAAACAGACAAGACAACATACACAGCCTGGAGACCAACCT
CAACAACAATGACGAGAACGAGGAGACGGAGGGCAGCGAG
GGTCAGGCCGAGTATCTGTTTGTAGACGCTGAATTAGATG
ATGATGAACTGTACAGCATGGAGCACGACAACCAACCAGC
AGAGGAGTCGGAGTACCTGCTCCCCCAGGAGGCGTTTCCA
CTGCGGCATGAGATCATGGATCACCCGTCGGCCCCGGAGC
CTCTGCAGGAAAAGCAGGAGTCTCCGCACGTGAGCGGCAG
CGAGGCCGAGAGCATGTGTTTGACTCCCATGGAGTCCTTC
AGTCTCATTTCCGTCTCGCAGCAGCTTTTCTCACCTCACC
TGCCTCCCAAGTTCTTCTGCCCCATCGTGAAGGAGATGCT
GTGCTATTACGCCGAGCAGGGAGACGTGCAGATGGCTGTT
TCGGTGCTGATTGTGCTGGGAGACCGCATCCGCAAGGAGA
TCGACGAGCTCATGCAGGAGCACTGGTACATGTCCTACAT
CGACCTGCTGCAGCGTTTCGAGTTGTGGAACGTCAGCAAT
GAGGTGATCAAACTGAGCACGTGCGGCGCCATCATGTGCC
TCAATCAAGCCTCCACCACTTTACACATCAACTGCAGCAA
CTGCAAACGGCCAATGAGCAACAAGGGCTGGATCTGTGAC
CGGTGCCACCAGTGTGCGAGTGTGTGTGCGGTGTGTCATC
ACGTGGTCAAAGGTTTGTTTGTGTGGTGTCAGGGCTGCAG
TCACGGAGGACACCTGGAGCACGTGATGGAGTGGCTCAAA
CAGTCCAAACACTGTCCTGCCGGCTGCGGACACCTGTGTG
AATACACCTGACACACACAGAGAACTGCACAACTCACTCC
AATCACGCTGCTACTCATGAGGGAAAACACACGCAACTAA
TGATCCGATGATAATCACACACTCTGTGGGAATCTGTTTG
TACATATTGGAATGTGCGCTTCAATACAATCAGGTTTTAT
TTTTAGTTTTCGGAGATTTTGTTTTTATGTCTATTCATGA
ATGTGGCTGAGATGCACTTGGCTTCGTGAGTGATTCGTTC
ACATTAAAAAAAATACTCTGGTCAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
wdr24-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000027074 (1),  Ensembl_Trans:ENSDART00000008047 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC045501 (1) 2914 bp
GenBank:EB936910 (1) 634 bp
CITATIONS (2)