header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9625
Transcript Name: slc2a1a-201
Previous Names: slc2a1-001, slc2a1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027037 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027037|OTTDARG00000021292|ZDB-GENE-030131-3158 slc2a1a|OTTDARP00000022159 slc2a1-001 LG_ AL772391.18 Danio rerio protein_coding KNOWN, 1792 bp
GGCAGTACGCTGAACGCACCTGACAGACCGAGTGACAACA
CACTGCCGACTGAAGACTTCTTTCAAAATGGCAAATAGGA
CGATATTCTCTGGATATTAAATGTTAAAGTTTTCGTGTCG
AATGTAATATGTGTTTTTGTTGAGGACTGCGGTTTTAAAA
GAAGAACAAGAATATAATTAGTGTATAGTTTTTTTTAAAG
AACAATTTTTGTCATCATGGAGTCTAATAAAAAGGAGGTG
ACTCCTCAGCTGATGATGGCCGTCGGGACTGCTGTGATTG
GCTCCTTGCAGTTTGGATACAATACAGGAGTCATTAACGC
CCCACAGAAGATCATCGAGGGCTTCTACAATGAGACGTGG
CATAACAGGTATTCAGAGTACATTCCGCCGACCACTCTAA
CCACACTCTGGTCTGTATCAGTGGCCATTTTCTCTGTGGG
CGGCATTCTCGGCTCCTTCTCAGTGGGACTCTTTGTAAAC
CGCTTTGGCAGGAGGAACTCAATGCTCATAGCTAACATTC
TGGCCTTCATAGCTGCTGCTTTTATGGGCTTTTCGAAGCT
GGCTGAATCCTGGGAGATGCTTATTATTGGACGGTTCATT
GTGGGTCTTTACTCGGGCCTGTCTACAGGCTTTGTGCCAA
TGTATGTTGGAGAAATTGCCCCGACTTCATTACGTGGGGC
GCTGGGAACTCTTCATCAACTTGGCATTGTCATTGGCATC
CTCATGGCACAGATCTTTGGTATTAAAGAAATCATGGGTT
CTCCCACATTGTGGCCCTTCATGCTTGGCTTCACCTTTAT
CCCAGCTGTGCTCCAGTGTGCCCTGTTGCCCTTCTGTCCT
GAAAGCCCACGATACCTCCTCATCAACCAGAACGAAGAGG
CCAAAGCCAAGAGCGTGCTAAAGAAGCTGCGTGGCACTGA
TGATGTGGGCGCAGACATGCAGGAGATGCGGGACGAGAGC
AGACAGATGATGAGGGAGAAGACAGTCACCATCCCCGAGC
TTTTCCGCTCATCACTGTACCGTCAGCCCATCTTCATCGC
CATCATGCTGCAGCTCTCACAGCAGTTCTCCGGCATCAAT
GCTGTATTTTATTACTCTACTGGTATATTTGAGAAAGCGG
GGGTGTCTGAGCCAGTTTATGCCACCATTGGTGCTGGAGC
TGTGAACACAGCATTCACAGTGGTTTCTCTGTTCATAGTG
GAGCGAGTAGGCCGAAGATCACTGCATCTTGTTGGTTTGA
TGGGAATGGCTGTGTCTTCTGTTCTCATGACTATTGCAAT
GGCACTACTGACAAAAGTGGAATGGATGTCATATGTCAGC
ATTGTAGCCATCTTCAGTTTTGTGGCATTTTTTGAGATTG
GACCAGGCCCAATCCCATGGTTCATTGTGGCAGAGCTATT
TAGTCAAGGCCCTCGTCCTTCTGCCTTCGCTGTCGCTGGT
TTCTCCAACTGGTTTGCCAACTTCTTAGTGGGAATGTGCT
TCCAGTATGTTGAGGAACTGACCGGCCCATACGTTTTCAT
CATCTTCACTGTCCTCCTGCTGATATTCTTCGTCTTCACC
TACTTCAAAGTTCCTGAGACCAAAGGCCGGTCGTTTGAAG
AGATCACAGCCAGCTTCCGCACCGGGGCAGATAAATATAA
CCGAGATGATTTGAACACACTGGGGGCAGATTCACAACTC
TGAGCTCTACACACAGGTTTATACAGTGAAGGCTATTTCA
CACCAGGGATGATAACTAGCACATTTTAACAATTGTTCTA
ATTTGATTAGATTCTTAAAGAATTTATAACAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc2a1a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000027037 (1),  Ensembl_Trans:ENSDART00000025414 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DQ152824 (1) 1696 bp
GenBank:EB889258 (1) 613 bp
CITATIONS (2)