Transcript

slc2a1a-201

ID
ZDB-TSCRIPT-090929-9625
Name
slc2a1a-201
Previous Names
  • slc2a1-001
  • slc2a1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027037 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027037|OTTDARG00000021292|ZDB-GENE-030131-3158 slc2a1a|OTTDARP00000022159 slc2a1-001 LG_ AL772391.18 Danio rerio protein_coding KNOWN, 1792 bp
GGCAGTACGCTGAACGCACCTGACAGACCGAGTGACAACA
CACTGCCGACTGAAGACTTCTTTCAAAATGGCAAATAGGA
CGATATTCTCTGGATATTAAATGTTAAAGTTTTCGTGTCG
AATGTAATATGTGTTTTTGTTGAGGACTGCGGTTTTAAAA
GAAGAACAAGAATATAATTAGTGTATAGTTTTTTTTAAAG
AACAATTTTTGTCATCATGGAGTCTAATAAAAAGGAGGTG
ACTCCTCAGCTGATGATGGCCGTCGGGACTGCTGTGATTG
GCTCCTTGCAGTTTGGATACAATACAGGAGTCATTAACGC
CCCACAGAAGATCATCGAGGGCTTCTACAATGAGACGTGG
CATAACAGGTATTCAGAGTACATTCCGCCGACCACTCTAA
CCACACTCTGGTCTGTATCAGTGGCCATTTTCTCTGTGGG
CGGCATTCTCGGCTCCTTCTCAGTGGGACTCTTTGTAAAC
CGCTTTGGCAGGAGGAACTCAATGCTCATAGCTAACATTC
TGGCCTTCATAGCTGCTGCTTTTATGGGCTTTTCGAAGCT
GGCTGAATCCTGGGAGATGCTTATTATTGGACGGTTCATT
GTGGGTCTTTACTCGGGCCTGTCTACAGGCTTTGTGCCAA
TGTATGTTGGAGAAATTGCCCCGACTTCATTACGTGGGGC
GCTGGGAACTCTTCATCAACTTGGCATTGTCATTGGCATC
CTCATGGCACAGATCTTTGGTATTAAAGAAATCATGGGTT
CTCCCACATTGTGGCCCTTCATGCTTGGCTTCACCTTTAT
CCCAGCTGTGCTCCAGTGTGCCCTGTTGCCCTTCTGTCCT
GAAAGCCCACGATACCTCCTCATCAACCAGAACGAAGAGG
CCAAAGCCAAGAGCGTGCTAAAGAAGCTGCGTGGCACTGA
TGATGTGGGCGCAGACATGCAGGAGATGCGGGACGAGAGC
AGACAGATGATGAGGGAGAAGACAGTCACCATCCCCGAGC
TTTTCCGCTCATCACTGTACCGTCAGCCCATCTTCATCGC
CATCATGCTGCAGCTCTCACAGCAGTTCTCCGGCATCAAT
GCTGTATTTTATTACTCTACTGGTATATTTGAGAAAGCGG
GGGTGTCTGAGCCAGTTTATGCCACCATTGGTGCTGGAGC
TGTGAACACAGCATTCACAGTGGTTTCTCTGTTCATAGTG
GAGCGAGTAGGCCGAAGATCACTGCATCTTGTTGGTTTGA
TGGGAATGGCTGTGTCTTCTGTTCTCATGACTATTGCAAT
GGCACTACTGACAAAAGTGGAATGGATGTCATATGTCAGC
ATTGTAGCCATCTTCAGTTTTGTGGCATTTTTTGAGATTG
GACCAGGCCCAATCCCATGGTTCATTGTGGCAGAGCTATT
TAGTCAAGGCCCTCGTCCTTCTGCCTTCGCTGTCGCTGGT
TTCTCCAACTGGTTTGCCAACTTCTTAGTGGGAATGTGCT
TCCAGTATGTTGAGGAACTGACCGGCCCATACGTTTTCAT
CATCTTCACTGTCCTCCTGCTGATATTCTTCGTCTTCACC
TACTTCAAAGTTCCTGAGACCAAAGGCCGGTCGTTTGAAG
AGATCACAGCCAGCTTCCGCACCGGGGCAGATAAATATAA
CCGAGATGATTTGAACACACTGGGGGCAGATTCACAACTC
TGAGCTCTACACACAGGTTTATACAGTGAAGGCTATTTCA
CACCAGGGATGATAACTAGCACATTTTAACAATTGTTCTA
ATTTGATTAGATTCTTAAAGAATTTATAACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations