Transcript

slc2a12-202

ID
ZDB-TSCRIPT-090929-9602
Name
slc2a12-202
Previous Names
  • slc2a12-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027013 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027013|OTTDARG00000021283|ZDB-GENE-040426-1513 slc2a12|OTTDARP00000022140 slc2a12-002 LG_ BX927365.7 Danio rerio protein_coding KNOWN, 840 bp
ACGCTGACCCTGTGTGTCAATGATCTTAATAGCTGCAAAT
GCTTTTACTTGTTGATCTGCGCCAAGAGAAATGGCACTGA
GAAATCCAAGATGTTGCACCACAACGCTTGAAGAACATGG
ATGCACCTGAGGAATCAATAAGGATGACGTCTGATCCCCA
GAGCAAAATATATGTGCAGAATCCAGACACACACATACAT
CTAGAGCAAGGCCCATCTGCAAAATCAGGCAATGGCAGAG
CTCTGGTCCTGTGCTCTGTGTCTGTGGCCTGCCTGAGTGG
CTTGCTGATGGGATACGAGATGAGTCTGATATCTGGAGCT
TTGCTTCAACTCAGGGACGTTTTGACTCTCTCCTGCCCGG
AGCAAGAGCAGGTCGTCGGCTCTCTTCTGCTTGGAGCCTT
CCTCCTGTCCCTGGGTGGTGGGACAATCCTGGACCACTAC
GGACGACGCTTCACCATCATCCTCACTGCTCTGTTGTGTG
TGTTGGGAACTCTTCTGAGTGTGTGTGTGGTGTCATTTTG
GGCACTAGTGGTCGGGAGAATGCTGGTTGGGATGTCAGTG
GCGCTGTCAGGCACAGCGTCTTGTTTGTATGCAGCAGAAG
TGGCACCAGCCGCCTGGCGCGGGAGGTGCGTGTGTGTGTA
TGAGTTAATGGTGGTTTTAGGGATGCTGTTGGGTTTTGGA
CTGAGCTGGGCGTTCGCTGGGGTTCCGGATGGATGGAGGT
TTACATTTGGTGGCGCGCTGCTTCCCGCTTTACTGCAAGC
TGGGGTTATGCCACTTTTGCCAGACAGTCCACGCTTTTTG
CTCGCCCAGCAGCGCGAAAAGGAAGCTCATGCCACTCTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations