Transcript

slc2a12-201

ID
ZDB-TSCRIPT-090929-9601
Name
slc2a12-201
Previous Names
  • slc2a12-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027012 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027012|OTTDARG00000021283|ZDB-GENE-040426-1513 slc2a12|OTTDARP00000022139 slc2a12-001 LG_ BX927365.7 Danio rerio protein_coding KNOWN, 2401 bp
CAAGGACAGACAAGTTACAGGCACCAGGGAGGAGAGAGTC
AAAAAGCTGCGATGATTTCATAGACAACATTCCCCTTCAC
TGACGCTAAAGAGTTGCACCACAACGCTTGAAGAACATGG
ATGCACCTGAGGAATCAATAAGGATGACGTCTGATCCCCA
GAGCAAAATATATGTGCAGAATCCAGACACACACATACAT
CTAGAGCAAGGCCCATCTGCAAAATCAGGCAATGGCAGAG
CTCTGGTCCTGTGCTCTGTGTCTGTGGCCTGCCTGAGTGG
CTTGCTGATGGGATACGAGATGAGTCTGATATCTGGAGCT
TTGCTTCAACTCAGGGACGTTTTGACTCTCTCCTGCCCGG
AGCAAGAGCAGGTCGTCGGCTCTCTTCTGCTTGGAGCCTT
CCTCCTGTCCCTGGGTGGTGGGACAATCCTGGACCACTAC
GGACGACGCTTCACCATCATCCTCACTGCTCTGTTGTGTG
TGTTGGGAACTCTTCTGAGTGTGTGTGTGGTGTCATTTTG
GGCACTAGTGGTCGGGAGAATGCTGGTTGGGATGTCAGTG
GCGCTGTCAGGCACAGCGTCTTGTTTGTATGCAGCAGAAG
TGGCACCAGCCGCCTGGCGCGGGAGGTGCGTGTGTGTGTA
TGAGTTAATGGTGGTTTTAGGGATGCTGTTGGGTTTTGGA
CTGAGCTGGGCGTTCGCTGGGGTTCCGGATGGATGGAGGT
TTACATTTGGTGGCGCGCTGCTTCCCGCTTTACTGCAAGC
TGGGGTTATGCCACTTTTGCCAGACAGTCCACGCTTTTTG
CTCGCCCAGCAGCGCGAAAAGGAAGCTCATGCCACTCTGC
TTCGACTTCGTGCTGGGATCAAAGAAGTCGAGCCAGTGGA
GGATGAGCTCCGGGCGATCCGTTTGGCAATGGGCGCAGAG
CGTCTTCATGGCTTCCTGGACCTCTTCCAATCCCGGGACA
ACATGCTTCAGAGGCTTCTTGTTGGCGCTGCGCTGGTGTT
CTTGCAGCAGGCCACAGGACAGCCTAATATTTTAGCATAT
GCCTCGACTGTTCTCAGTAGCGTAGGCTTTCATGGGAATG
AGGCGGCGACTCTTGCGTCTACAGGGTTTGGTGTGGTTAA
AGTGGGTGGAACCATTCCTGCAATTTTTCTAGTGGACAAA
GTTGGGCCTAAAGCCCTTCTGTGTGTTGGAGTGGTTGTCA
TGATGTTGTCAACAGCAACGCTGGGGGCCATTACTATGCA
GAGCCGCACACACGTTTCCAGCCTATGCAGAGGCCCCGGT
AATACAGCAAACTTCACGTTATTTGAGACCGGAGATGAGA
CTGATATCCAGACCAACACTCCACTGGGCTTATACCAGCC
TCAAAACAAGCTCAAAACAAACACTTTTCTCACAAGCATT
AATGACACTAGAGAGCATTGGATTTTAAATCACACCTATA
ATCATAGGACTGCTTTAATGGAAACCGCTGAGCTTTCGAA
GAAAGACAGTGCAAAGATTGCGCTTCAGTCTCTTCACGAA
GTGTCGCCTTCGCTGAAATGGATCTCTCTGGTCAGCCTGC
TGGTGTATGTAGCTGGATTCTCCATCAGCTTGGGACCAAT
GGTTCATGTTGTTTTAAGTGCAATCTTTCCTACTGGCATC
CGGGGGAAGGCTGTATCTGTCATCTCCGCCTTTAACTGGG
CCACAAATTTGCTCATATCGATGACCTTCCTTACCCTGAC
AGAGCGGATCGGCCTCCCTACTGTCATCTTCTCCTACTCT
GCTATGAGCTTCCTGTTGGTGGTGTTTGTGATTGTGTTTG
TGCCAGAGACCAAAGGCCGATCATTGGAACAGATCTCAAA
GGAACTTGCAATGAAGAATCACCTGAGAGGCACATTGCTG
TGTCACAGAAGAAAACACAAAGCTACAGCACAGCCCTCAC
AGGAGGAAAAAGCCCTCGCAACAGTTTGACTTTTTACCTA
GATGAAGAGTGAAAGAGCAACTGATCAGACAGCTGAACCT
GTGACTGCACCAATCAGAGAATTGAAGATATCTGCCTGAT
TTATGTTGTGCTTTCCCCATTTAAGAAAAATGTAACATGC
CAATCTGATTCATTGTATTCTTCATGTATTTTAAGTAATT
CTGGATTTATATGGAGCTTTTACTACTCACTGTTATGAAA
CTCTGGAAGGAAACTGTGCAATCATTAGCATAATCATGCC
ATGGCATGTCCAAGGCAAGTTCTGTGGCAAAGTCACATAT
CAGTGTTTGTGTGCTGAACATTACCATAAATAACAGTTTA
AAGTATGGCATGAGATGCCTTGTATAATCATGTTACACAA
TTGTGAATCAACATGTTATGTAATATTTCAAAATTATATT
GTTGGTTGTTCATAAAAGTTGTCCGAATGGTTTTGACCAG
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations