Transcript

hsd17b12a-003

ID
ZDB-TSCRIPT-090929-9506
Name
hsd17b12a-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026914 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026914|OTTDARG00000021234|ZDB-GENE-030131-5628 hsd17b12a|no_translation hsd17b12a-003 LG_ CR376745.11 Danio rerio protein_coding KNOWN, 885 bp
CAACCCTCTGCACTTTACTGCGGCTGCATGGCAACACGCA
TGGAGACCATCAATAGACTGTTTTTATATTTCATTTAATA
AGTACTGAAGTGGAGTACAGTGGGTGACGGGGTTGTTAGG
TTTCAAACACATCATGTTTGATGTTTATTTCATATGTCTA
TAAGAGCAGTTGAAATTAAGTTTGTGTGTTTGTTTCAGAG
CTAAAGGTGTCATCCTCAACATCTCCTCTGCCAGTGGCAT
GTTCCCAGTCCCACTGCTGACCATCTACTCCTCCACTAAG
GCTTTTGTGGACTTCTTCTCACGAGGACTTCAAACAGAGT
ACAAGTGCAAAGGGATCATCATCCAGAGTGTATTGCCTTT
CTTTGTGGCTACTAAGATGACCAAGATCAGGAAGCCCACT
CTGGACAAGCCCACCCCCGAGCGCTATGTAGCTGCTGAAC
TGAACACTGTGGGACTGCAGGACCAGACCAACGGCTATTT
CCCTCACGCCGTCATGGGCTGGGTGACCACCATTCTGGCC
CCCATCGACCTGGTCCTCAACCTGGGTCTGCGCATGAACA
AGGCCCAGCGTGGCGGGTACCTCAGGAGGAGAAAACTGCG
ATAGGACGAGGACATAGTGTGATAGACTCCAAAAGGGCCA
AAATGTTTTACAGAATGCATGTACTGAGATTTGAGTCAAT
TAGACCTCAAATCTTTGAAGTGCTGCCTCTTAAACACACT
TTTTTTTTTTTTTTTGTATGTGTGCATGTGTTTTGTGTGT
GTGCGATTGTTTGTTTTTTGATTAAATATCTGGACATGCT
CACGTTCCACAATGAAGTGCTAGTTAACCAAAAAGGGGGC
TAGTCTTTCTTTGAGGGTGAATAAAGCATTATGTTTGGCG
GAGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations