Transcript

hsd17b12a-002

ID
ZDB-TSCRIPT-090929-9505
Name
hsd17b12a-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026913 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026913|OTTDARG00000021234|ZDB-GENE-030131-5628 hsd17b12a|no_translation hsd17b12a-002 LG_ CR376745.11 Danio rerio protein_coding KNOWN, 755 bp
AAGCAGTGCTTAACGACTAATTTTGCAGGTCATTCACCAC
GCGCAGCCAGCCGTAGACATGGAGTCGTTTAACGTGGTGG
AGACGCTACAGCCTGCCGAAAGAGCGCTCTTCTGGGTCGG
TGCACTTATCACGGCCTCGCTGGCGTTGTATGTGGTGTAC
AAGACCATCACTGGATTCAGGATATGGGTGCTGGGAAACG
GGGACTTACTCTCTCCCAAATTGGGAAAATGGGCAGTTGT
GACGGGAGCCACGGATGGGATTGGGAAATCCTATGCGGAG
GAGGTAAGGGTTTCTCTTCTTATTTATCTGTTCGCTCCAC
GGAAAGCACAGTGACTCATCACAAGACAGAGGTTTCACTC
TGAGGCCAAGAGAAGGAGGGTGACTGGAAGACTGCTGGTG
GGAAAAGACCTGTTACCTCGTTTAACTTGTACAGCTAAAA
GTTGTTCTCGCACTCCAAAGTTGGCCATTTCATAACCGTT
TAAAGAGTATGGCGGTTTCTTACAGGTTTCCCCTCAAACA
TTAAGGGTGCTTTCACACCTGTGAATAGATTCAGTTGTTT
CGAAACAGAGATTACAATTGTTACATTGTTGCTCTTTGCT
CTTGGAGCGGTTCGCTTTCACACTGCAAAGTTTTTAATCA
AACCAAAATAGCTAAAACAAGTCACGTGCGATTAAACTCT
CCTTACATTGGTCAGAGTGTCAGGGTTTATTTTGTAGCGT
CCCGCTAAGCTGTCAGGAGAGGTGGTGGTTTGGTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations