Transcript

foxi3b-201

ID
ZDB-TSCRIPT-090929-9483
Name
foxi3b-201
Previous Names
  • foxi3b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026888 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026888|OTTDARG00000021218|ZDB-GENE-031126-4 foxi3b|OTTDARP00000022043 foxi3b-001 LG_ BX248097.7 Danio rerio protein_coding KNOWN, 1865 bp
AATACAGCAGAAGAAAGCACAATAGCACTGACAGAGGACA
CAAACAGGAGCTCTTGAAAATATTCTTAGGGGATAACATA
AAAGAGAAGGTCATCAGAGGACAGGAGAAATAGAAAACAT
AACAGACTTTTTTTCTTATGCCAACTGGAGCACCCTCAGG
ATCGAGCAATGACATCCTACGAGTCTCAAGGTCAGTCTCC
GACAAGATGTGGGCCTCAGTTCCCTAGCCTAGGACAGGAA
CCTCCAGAACTGAGTCTGTACAGCGACAGCTACTATCCGC
CTCCATCCCTTCCAAGTCCACAAAGAACCAACCCGTCTTC
ATACGAACTTGGAGACTATGCCGCCTCCTCACCTAACCCC
TACCTGTGGTTCAACAGTCCAGGAATGAACAGCGCTCCTT
ATCTGGGAGGAACGCCTGGCCCTGCTGGACCTTCTTTCGT
TCCCCAGCACTACGGCATGCAGAGGCCCTATTTAGGACCT
GGGCCACCAGGTGGTCCTGGAGGGGAATTGAGCTGGTTCT
CCATGCCGTCTCAGGAGGATCTAATGAAGCTGGTCAGGCC
ACCGTATTCATACTCCGCTCTTATTGCGATGGCTATACAT
GGTGCCCCAGAACGCCGCCTGACCCTCAGTCAGATTTATC
AGTATGTTGCAGACAATTTCCCTTTCTACAACAAGAGCAA
AGCAGGATGGCAAAACTCAATTCGACACAACCTCTCACTC
AATGACTGTTTCAAAAAAGTTCCACGAGATGAAGATGATC
CAGGAAAGGGCAATTACTGGACCTTAGATCCGAATTGTGA
AAAAATGTTTGACAATGGCAACTTCAGACGCAAGAGAAAG
AGAAAGTCTGACAGTCTCCCAGAGAAAAGCAGTTCTGGAG
GGAATGAGTCAGGAGACAGTAATGGCAGGGGTAGCCCGAA
AAGTCAATCCATTGACATTTCCACTTCACCAGAAAAGGGC
CCATCACCCGCATCCACGGGTCCATCGCCATGCTTGAGCA
ACTTCCTGACTGAGATGTCTGGAGTTGCGGCCGGATCTCT
TGACATGGAAGCGGATCCCCTGAGTCGCCCCTTTACACTC
AGTCTGCCAGTAGACGGGGCACAGAGAGCTTCACAAACCA
CAGGTTTTTCCACCTTCACTCCAAGCACTACGGTGTCCGA
TTGGGCTTCACCTCTGCCCCCACCGCCACCCATGTCCTCG
TCACCCTCCCACTCCACGTTAGCTTACAGCGGACCTGTTC
TCAGTCAGTTTAATGGCCATTTCTTCCCTGGTTTGAGCTC
AACGGGTATTCTTTACCCTCGGGAAGGCACAGAGGTGTAG
GATGGGAAGCAGACGACAGACAAGCTGATCAACCAATTCA
TGTTACTGACTATGGGGGTAAGAAAAAACACTGTTGTTTT
CCTGAAACTATACACTGCTATTGGCCTAACTGAACTCCTT
TGAGTTCTGTGGGCACAAGATACGAATGAATTCCCACAGG
AATAGCCTAGTCAGCAGCAGATATGACAGGCTGACTCCAG
CAAAAGGCCCCTGCTACCAGCAGCTCTGACCCGAGGTCAG
CTGCTGACATCAAGCCATTCTACACACCCATCTCATTCCT
AACTCATATTACTGTCACTGACTGCAAACACCTGTAACGA
AACTGAGCAGATAAGCAGAGAAAATGCATATGGTGTAGCA
GATTTTCTTCTTTTGCTGCATGCTGGTGTTGTCATATGAT
CCTGTCTGCCTTTGTATTTTAACATGACTAATTTTGTTTA
TGTATATTTGTTGTATGTGTGAATGTTGGAATTTATTTTA
TTTTATTTTACTGAGGTTCCTTAAAGGTGTATATTGTTTC
CTTTTTTAATAAAAATATTTAAAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations