Transcript

fzd8a-201

ID
ZDB-TSCRIPT-090929-9475
Name
fzd8a-201
Previous Names
  • fzd8a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026880 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026880|OTTDARG00000021214|ZDB-GENE-000328-3 fzd8a|OTTDARP00000022036 fzd8a-001 LG_ BX004842.13 Danio rerio protein_coding KNOWN, 2604 bp
GAGAAAGCCTCTCGCGAACACCACGAATGTTGAAAACGCG
TTTACACCGGGAGTTTTCTTGTTGACAGAGAAGTTTTGAA
GAACAAACCGCGGCTTTATTTTTTAACACATCGCCGGAGC
GGGAATAAGGAGAGGAAATACGAGACGGCTGCATTTATTC
CCTCAGCCATTTTGCCTGCGCCCGCCCGAGGGCTATTTAT
TCTCGGTATGCAACCCAACCGCGACTCCGTGCCAAACAAG
TGAAGCGGAGATGGGTCTGCTCTGCAACATCTGAACTGAA
CTGTTCCCAGCGCCGCGTTGCTTGTGTTGACAGGATGGAG
TGCTACCTGTTGGGGATTTACCTGTTCCTCGCGCTGGCTC
TGCTGCCCCGATCGAGCGGTACCACGGCCAAGGAGATCAC
CTGTCAGGAGATCGCCGTTCCGCTGTGCAAGGGCATCGGT
TATAACTACACCTACATGCCCAACCAGTTCAACCACGACA
CGCAGGATGAAGCCGGCTTGGAGGTGCACCAGTTCTGGCC
TCTGGTGGAGATTCAGTGCTCCCCGGATCTCAAGTTCTTC
TTGTGCAGCATGTACACCCCGATATGCCTGGAGGACTATA
AGAAACCCCTTCCGCCGTGCCGGAGCGTCTGCGAGAGAGC
CAAGGCGGGCTGCGCCCCGCTCATGCGGCAATACGGCTTC
CCTTGGCCGGATCGGATGAGGTGCGATCTACTGCCCGTGC
AAGGAGCCCCAGACACGCTGTGCATGGACTACAACCGAAC
CGACTCCACCACAGTGTCGCCGGTGCTGTCCAAACCCACC
AACTACCCCAGCAAAGCCATTAATCCGCACAAAAAGAAAA
GCGGGCGGCCAGGCGTCGGACCCAATAAGAATAAGCCCTG
CGAGCCGGGCTGCCAGTGTCGCGCGCCGATGGTGCCGGTG
AACAGCGATCGACACCCGCTCTACAACCGCGTTAAGACGG
GTCAAATCCCAAACTGCGCCATGCCATGTCACAACCCATA
TTTTACGCAGGATGAGCGGACTTTTACGGCCTTCTGGATC
GGACTTTGGTCCGTGTTGTGCTTCATATCCACCTTCGCCA
CAGTCGCCACCTTCCTAATCGACATGGAGCGGTTTAAATA
CCCAGAGCGCCCTATTATTTTCCTCTCGGCGTGCTACATG
TTTGTGTCGATCGGGTATATAGTGCGATTGATCGCCGGGC
ACGAAAAAGTGGCGTGCAATCGGGAGTATGACGTGGAGCA
CATTCACTACGAGACCACCGGCCCCGCGTTGTGCACCGTT
GTGTTCCTGCTTATCTACTTCTTCGGAATGGCCAGCTCCA
TATGGTGGGTCATCCTCTCGCTCACCTGGTTCCTCGCGGC
GGGCATGAAGTGGGGAAACGAGGCCATCGCGGGCTACTCT
CAGTACTTTCACCTGGCCGCTTGGCTCATCCCGTCCATGA
AGTCTATAGCCGTCCTCGCGCTGAGCTCGGTGGACGGAGA
TCCGGTCGCCGGGATCTGCTACGTTGGCAACCAGAACTTG
GACAATCTGCGGGGCTTCGTGCTGGCCCCCCTGGTCATAT
ACCTATTTATAGGCACCATGTTTCTTTTGGCTGGATTTGT
GTCGCTTTTTAGGATCAGGAGTGTCATTAAACAGGGGGGC
ACTAAAACGGACAAGCTGGAGAAGCTGATGATCCGAATTG
GGATTTTCACGGTGCTCTACACGGTTCCCGCCACCATCAT
CGTGGCGTGTTATTTCTATGAGCAGCACAACAGACAGAGT
TGGGAGATCACTCATAACTGTTCGTGTTTACTGGAGCAGG
AGATCAAGAGGCCGGACTATGCCGTCTTCATGCTCAAATA
CTTCATGTGCCTTCTGGTGGGCATCACCTCTGGAGTTTGG
ACCTGGTCCGGTAAGACATTGGAGTCCTGGAGGAGTTTCT
GCACGCGCTGCTGTTGGGGCAGCAAGGGCTCCGGTGGCTC
CATGTACAGTGACGTGAGCACGGGATTAACGTGGAGGTCC
GGTACCGCCAGCTCCGTGTCGTGCCCCAAGCAGATGCCTT
TGTCCCAAGTCTGAAACCAGAAAACCCCATTAATTGTTGG
GGGTCTCCTGGTCTTTCAGACATTTGCATACAAATGAACT
TGTTGATGGTTTCTATTAGCCGACGGACTGGTTGAAACAA
TGCAGCGATGCAGAAACAATTACGTTTCGCTAATTCCATT
CTATTGATATGGACATGACATGCAATCAGTCATTCTTAAG
GAGAATTCGGGCATTACATTGTTCCTAGTGGAGTAACACA
TGTCCCCAACTTGCAGCATTTTTATTTTTGTCTCATTTAC
TTTTACACGTTGTTGAAAGACAAGTTTTGAATTGTCTGAA
CAATCAAAGATGGTTTGAATAAGCCTTAACGTCTTAGTGC
CCAATTATTATTGTTATTGTTATTATATACGGGTTGTTTT
CTCTATTTTTTCTTTCTTTTTGCTAAATGTATTTATACGA
ACTTGTAAATGGTGTATAAAAGATGATTTATAAAATTTAT
TGTAAATTTGTACATAGTGTAGATGCCACACGAAAAGCAA
ATATGACTTTTATTTTGACAATAAAAACTTTTTGAGGAAT
CTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations