Transcript

nkap-201

ID
ZDB-TSCRIPT-090929-9466
Name
nkap-201
Previous Names
  • nkap-001
  • nkapl-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026864 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026864|OTTDARG00000021205|ZDB-GENE-030131-8064 nkap|OTTDARP00000022021 nkap-001 LG_ BX571981.5 Danio rerio protein_coding KNOWN, 1730 bp
ATTGAGCGTGCTTCACGCCAATGAGATGTACGTCACATTA
GAAGAATTTAGCGTAGCGGAAACATAAACACAAGCAGGCT
AAAGTTCAGCGTTGCTAGTGTGTATGTTTTGCGTTTAAGT
TGTGTTTAGGTTTCTCGGTGAGTCTCAACACATTCATAAT
ATTCCTAACTAAGTATTTTGTCGCAGTGCTAAAAGTGATT
TAAAACCGCTGTTTGCTAACGTACATATCTAGCTGGATTA
GCTTGGCTCGTTCTTGGTGAACTGCGACATGACTAGCAAA
ACGTAACCAATACGTCCCTTTTAACAGAACAAAATAAGGG
AATCAAAGACGTCGTTATAGTGTAGTAATGCCTGAGCTAG
ACGTGAAGCATTCAGGCTCTGTGAGCCCGAGGAGACGCAG
ACACAGCCGCTCCAGCAGCCGATCCCCGGACCGAGCACTG
AAGAACCACAGACACAACCATGAAGACGAGCACAAATCAC
GACACGGCGACAAAGACCGCAGCAGAAACCGCTTCCGAAT
GGCGTATTCCCGCAGTCGCTCGAGGTCAAGGGAAAGGGAC
CGACAGACCTGGTCGGACAGAGATCACGGATTCTCCGATT
ACTATGAAAAAAGAGACGACGCTCAACGACAGAGACAAGA
AGCCTTCATCGCGAGGCGTCTGCAGGAACGAGAGAGAATT
GGTGAAATCGGATGTCCAGAGGTTTGGGGATACTCTCCAA
GAGTCAGAGAACCTGATTCAGATGAACACACTCCTGTAGA
AGAGGACGTGAAGAACAGCAGCTCTGATTCAAGTTCAGAG
GAGGAAAAGAAGAAAAAGAAAAAGAAGAAAAAAAAGAAGT
CCAAGAAGAGGAAAAACAGGAAGCAGTCAGAAGACAGCGA
GTCAGAAAGTGATTCTGAAGAAGAAATGAAGAAGAAGAAA
AAGAAGAAGAAAAATAAAAAAAAGAAGTCAAAGAAGAAGA
AGGCCAAGAAGAATCAGAAAGAGTCCAGTAGCTCTAGCAG
CGAACATTCAGAGGAGGAAGAAGAGGACGCCAATGAAATC
TCCTGGGTGGAGAAAACTTGTGTTGGAGAACATGTGGTTG
GTCCTGACGCCCCGCTCACTCACCTGTCCCAAGATGATAA
ACCTTTAGATTTTGGCCACGCTTTACTGCCAGGTGAAGGT
GCCGCCATGGCAGAGTTCGTCAAAGCAGGAAAACGTATCC
CAAGAAGAGGAGAAATCGGCTTGACCAGTAATGAGATCGC
GGAGTTTGAGAAGTCTGGCTATGTCATGAGTGGAAGCAGA
CATCGGCGTATGGAGGCTGTGCGTCTGAGAAAGGAAAACC
AGATCTACAGTGCTGATGAGAAGAGAGCGCTTGCGTCCTT
TAACCAGGAGGAAAGGAGGAAGAGGGAGAGCAAAATCCTC
TCCAGCTTCAGGGAAATGGTTTACCGAAAAACCAAAGGCA
AAGACGAGAAGTAGGCAGTCCTGTAGAAGTCAGTTTTCAG
TCTGTTTGTCCTTGTTTTTCTTTTTTAAAAAGAAGACGAT
GCAAAAGTTGAATAAGACACAGATTTTACTTTAGAGTGTT
TAAATGTATAATACACAGCGAGAGGCCTCAACTGATGTGT
ACATTTTAAAATCAGAAATAACAAACTGTGATTAGTAGAA
CTCAATTCAGAAATCACTGCAATACAATTCCTGTAATGCG
TGTTTTGCGTTAAATAAATGGATGCGTCACGTGACCCACT
GTAAATATGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations