Community Action Needed: Please respond to the NIH RFI
Transcript

hey1-201

ID
ZDB-TSCRIPT-090929-9420
Name
hey1-201
Previous Names
  • hey1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026812 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026812|OTTDARG00000021175|ZDB-GENE-000607-70 hey1|OTTDARP00000021978 hey1-001 LG_ BX927165.19 Danio rerio protein_coding KNOWN, 3322 bp
TCATACGGATGAACGTTTGTCTCACCTGACGCACGCTGAG
GATACGCGCTGCTAAACTGTCGAAAAATGAAGAGAAATCA
CGATTTCAGCTCGTCGGACAGTGAGCTCGATGAGAATATC
GAAGTGGAGAAGGAGAGTGCGGATGAAAATGCCGGTGCGA
ATTCTCCACTCGGGTCAATGTCTCCATCCACAACCTCTCA
AGTACAAGCAAGAAAACGTCGCAGAGGGATCATCGAGAAG
CGCCGGAGGGACCGGATAAATAACAGTTTATCTGAGCTGC
GCAGGCTGGTGCCCAGCGCCTTTGAGAAACAGGGCTCAGC
TAAACTAGAAAAAGCAGAAATTCTGCAGATGACCGTAGAT
CATTTAAAGATGCTTCATGCTGCAGGAGGAAAAGGTTACT
TTGATGCTCACGCTCTGGCCATGGATTACCGAGGACTGGG
TTTCCGCGAATGTCTAGCAGAGACTGCACGTTACCTCAGT
ATCATCGAGGGCCTGGACAACACAGATCCCCTCCGCATCC
GTCTGGTTTCACATCTCAATAGCTACGCCTCTCAGAGAGA
AGCTCACTCGGGTTTGGGCCACTTGGCATGGGGTTCTGCA
TTTGGAACGCCTCCCAGTCACCTGGCCCACCACCTCCTCC
TGCAACAGCAGCAGCAGCAGGGGGCGCCACTGGCGCGCAG
TACCAGCAGTCCTCCATCCTCAAACTCATCATCGCCCTCC
TCCTCGTCTCCTTCCGCCCCGTCAACAGAGCCCAGGTTGA
GCGGGACGGTGATCAGTGAGGCAGGGCAGACGGGACCGCT
AAGGGTGCCACCCAGTACCTCCCTTCCCCCAGGCCTCACT
CCACCTACTGCATCTAAGCTTTCTCCGCCCCTCCTGACGT
CACTTTCAAGCCTGTCAGCGTTTCCCTTCCCACTGAGTGC
TTTTCCTCTGCTGTCCCCAAGCTCACTGGGCCCCGCAACG
CCCTCCAGCAGCCTAGGGAAGCCCTACAGGCCCTGGAGCA
TGGAAATAGGGGCCTTCTGAACTCAACACGAACGCTTTTA
GAAATGACTTCTTTCTGTAACATCAGACTATTTTGAACAG
ATGCACAGAAACAGACTTGTACAAAGGGAAGACACGAATA
CAGATCCACTCTACTAACCAGAACGACTGTGCTTGTCCCA
TCTCAGCAGGTGATGAGTTTTGGAAATGGTCCAATTTTCA
CCCAACTGATTTAGTCCTTTTGTCCCTCAGGGTACACTGT
AAAAAATATCTTCCATATTTTGTGATTCATGTTTTTATTT
TGAAGTTTTCCCCTTTTATTTATGTTTTTGAATTACATTA
TGGGACCTTGAATGTTCTTCTAACAGCTTTTAACCTTGAA
ATTTTAGAAAAAGTGACTTTTTAAAATATTTTAATACTTT
AAAGTGATAAATTGTCTGGGTTGATGTTGTATATTACGGT
ACAAAACCCTTGTAATAAGCTGCCAGTACATGTTCTGTTA
TTTTACAGACTTATTTCTCTATATATTATTTCTTATATGC
TGTAAAACCCAAAAAGTCAAGGTAACTCAAACCATTTAAG
AAACCGATTGCGACAAACTATTTAAGTTTAAAAACTAATG
CAGATGAGTACTGTGAACTTAATCCATTTGAGTAAACAAA
GCAGTTTGAGCACAGTAAAACCCAATAAATGAAGAGAACT
AAAACGCTCAAAATGCTACAAACCTTTTAAAAAACTTATT
CCATTTAAATTGAAGTAATGAGGTATTTAATTAACTCATT
AGCTCCAACACTGAGTTCAAATGAGTAGAATGAACTCTCA
GTCAATTTTGAGTTAACTACACTCGTTTCACTTGCTAAAG
TGACTGTTGGGTTTTACAGTGTAAATTTATTTTTTCAAAC
TCCTAAAATGTCAATAAAAGTCACTTTGTTAAACTGTAAA
GCTGAATTTTTAACATCAAAAGTCGCCAGAGCAGAGATCA
AGGTCCCATAATGCACAACCGTAAATAAACTGAAAACTGA
ATCACAAAATACAGAAACTGTTAATTAACAAATAGTTTTT
ACAGTGTACGTTTACTCGACAGTGATGTACTAAAAATTGT
GATTTATTTTTTAAAATTTGGCATACTGAAAACAGTGTTG
TCAAAATGATTCCCTTTCATGTGGATCTGCAAAAACAACT
AAAAACGGCGCATTGTACAGTACATGCCAGGCCAGTAGTT
GGCGATGTCGCTTTGTAAATAAACACTACGCGACTGCGCA
CATTTTTGATTGTTTGCATTTTCACGCCCCTAAAACACTG
CTGTCGTGTAAAGTGAACTTAACACTTGTTTTAAACCTTC
CAAAATGCAATAACCCTTCAGTTTTTGGTTGAAAACAGTG
TCCTGTAAGCACACCCTCAGTGGAGAAATTATACAAAATG
TCACATTTTGAATACTGCGCCCTCTAGAGGTCCCATCTAT
GATTTGTTCATAAAAAACCATAATAAACAGAAAGTTATTC
CTTTTGAAGGGTACATACTTCTATTGTGGCGGTTCATTCC
GCTGTGATGACCCCTGAAAAATGAGAGGCTAAGCAGAAGG
AAAATGATTGAATAAATACTTGTATGGTTAAAGACAAATG
TGAGCACTAGAGGGCGCAGTATATAAAATGAGAACCAGGC
AGAGAGAGAGAGGTCATTTGAAGCCAAATGCATCACTGAA
TTGATGTTAAACTCAAACCAGATGCTCATTTTATAACAAT
AAAGATAGTTCAGGAACAATTAGTCCACATGCAACAAAAA
TTAGCCTCTTAACTCCGGGAATTACTTTGAATGTTTAGAA
ATATGTTGGAAAAACCTATGCAATGACATTGATGTTTTGG
AAATTTCCCTTCACAAAAATATGTGAAATCTATGCAACCT
ATGTATTCCTCAGCTGAACTCGATGAGTACTTTATTTTTA
TAAAGATTATACGTCCAGTGACCTGCAGTGTGTTTTTTTT
TTTAGATGTAATGAATTTGCTGTTTGCAGAAATGGATCTT
TATCGAGACAATCTAGATAGACAATCTCTCAGAGCTGCTC
TAATTTAATTGTAGCGAAGGCACTATTAGGTTTGTTAATA
GAGAAAATGTGCATATGTTTGCCCTTTATGCTCAAATCAT
CTCTCTCTCTCTCTTACAGTTATCTGTACTTGAGGAGTGT
TTTGGAAAACCAGTTTTTTTATGGCAATAGGGATTTTACA
CTGGCAAATCAGATAAGATTAGGTGAATAGATAGTACTGG
AAGAGATGATGTGGTACTGTGCCTGTCCCTCACTAACCTG
TGTGACTTTCCTGTAATAAAATATGTGTAGCTAACAACTC
TG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations