Transcript

mxtx2-201

ID
ZDB-TSCRIPT-090929-9360
Name
mxtx2-201
Previous Names
  • mxtx2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026739 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026739|OTTDARG00000021128|ZDB-GENE-000710-6 mxtx2|OTTDARP00000021921 mxtx2-001 LG_ BX248124.7 Danio rerio protein_coding KNOWN, 1327 bp
TCTTCATCAGTAGCACAAGGAGCAGCGACAAGCTTGACTT
ACTTATTTTCTGCAAGAGAGCTGCAAAATACTCAATGAAA
GACATGTGGACTGACTGCATTGCTCAAGATGGAAACTCAC
AGGCCAGTAAGATTGCAGGCCGCAGGAAGAGAACCAGCTT
CACCAAAGAACACTTGGAACTTCTCAAAATGGCTTTTAAT
GTGGACCCTTATCCTGGCATTAGTGTCAGAGAAAGTCTAT
CTCAAGCCACTGGCCTGCCAGAATCACGTATTCAGGTATG
GTTCCAGAACAAGAGAGCCAGAACCCTAAAGAACAGAGCC
ATTCAGAGCTCCCCACAGCTGGACAACAAATCTCCTCTTC
CTAGCCCTTTCTTACCTCCTCACATGGCTTCTGTGGGAGT
CAGCGCTCAACAGAGAGGCATTCAGGAGTCACCCTTCAAC
ATCCAGATGTCTCAAACATCTCCACAGCACTTTACCTTTC
CTCCAAGCGACTACAGCACACCTGTTGTAAAGCCTCGACA
AACCAGACTGATGGGAACCAGCTCTTGTTCTCCATCTGAT
CTGCAAGCAACACCAGACAGCTGGAGCTATGCTGGAAGCA
CACAGATCTCTCCTGAGTCATGGGATGTAGCAGCAGAGAA
TTTTGGGAATTCCTACAAGGATGAGAGTCCATTTTTTCTC
TATCCACCACCTCCTTACCCTTATGGAAGCACCAGAGTTG
GATGCCCTAGTAGCATGGAGTCACTTTCAACATCTCCTGC
GTCTTCTGATTCTGCATTTTGGGACATGGGATTGGAGAAC
TGCTCTCCATCTGTGCCTTACACCAGCTGTGGCAGCCCAT
GGGACAGGCTCACAGAGGAGCAGCCAGTGGCCCCTCTTCC
AGATCTGTCTTCTCAGTGTCTGGAGGATGTGCTCGGGGAA
ATGGAGCCAGCCTGGTGGAGCTTCAATGGCCAGATGGATC
TTTAGCAATCTTGCAAACATCCATAACCTACAGAGACAAA
CAGTGTTTTAGTATTGAGGGGGTGCATTTTTATTTTTGAA
TTGTATTATATGGGGCGCATGGTATTGTGCAAGTGCAGGT
TACAAAGCAATATCACATATGCATATTGAACTTTTATTTA
TGGACTTTATTTATTTATATTTATACCAAATGTAGATTGT
AATGAATAGCCTATGGTTGCACTAGCTTATTTATTCTTTA
TGCTCTTTTTTTAAGGTATTTTGGTGCAGTTGGGGTATTT
ATTACTACATTTAATGCAGTTCACACAGCCTATACTGTCA
CTTTGTAAATTATTGTATATTTATTTGAAATAAAATGCTA
AAATGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations