Transcript

gpd1l-202

ID
ZDB-TSCRIPT-090929-9335
Name
gpd1l-202
Previous Names
  • gpd1l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026705 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026705|OTTDARG00000021105|ZDB-GENE-041010-220 gpd1l|OTTDARP00000021890 gpd1l-001 LG_none CR925805.15,CR848829.10 Danio rerio protein_coding KNOWN, 2741 bp
GATGACGCAGTCAAAAGTGGACCAACACGTTCCCTCCTAC
TGAAAAAAACTGCTCGACTTTGTAGTATTATTACCTATAT
TGTTTACTTAAAACATTTATCAACTAACTTAGTTGTTTGC
AAACGTGGTTATGGCTGCTCCGCTGAAAGTATGCATTGTC
GGTTCCGGTAACTGGGGCTCTGCGATTGCGAGAATTATTG
GCAGCAATGCACAGAAACTCCAGTGCTTTGCCACCACAGT
CAAGATGTGGGTGTATGAAGAAATGGTCAATGGCAAAAAG
CTCTCCGAGATCATCAACACAGAGCATGAGAACGTCAAGT
ACCTGCCAGGATACAAACTCCCAGAGAATGTGGTTGCAGT
GCCACAGCTTCGGGACGCCGCAGACGGTGCAGATCTTTTG
GTTTTTGTGGTTCCTCACCAGTTCATCCGGAAACTGTGCG
ATGAGATGATGGGCTGTGTTTCAGAGAGGGCTCGTGGAAT
TACTCTAATCAAAGGCATTGATGAAGGACCAGAAGGACTG
AAGCTCATCTCGGACATCATTCGGGAGAAAATGGGCATCG
ATGTCAGTGTCCTAATGGGGGCCAATATTGCAAACGAAGT
AGCAGCTGAAAAGTTCTGTGAAAGCACCATTGGCAGCAAA
GTGTTGGAGAACGGCCTCTTGTTCAAAGATCTCCTGCAGA
CGCCTAACTTCAGGATCACTGTGGTGGATGATGCTGACAC
AGTGGAGCTCTGTGGAGCCCTCAAGAACATTGTAGCAGTG
GGCGCAGGTTTCTGTGATGGTCTGCAGTGCGGAGACAACA
CCAAAGCGGCCGTTATTCGCCTGGGTTTGATGGAGATGAT
CGCTTTCGCCAAACTTTTCAGCAAAGACGACTCCGTGTCC
TCTGCCACCTTCCTGGAGAGCTGCGGCGTGGCAGACCTCA
TCACCACCTGCTATGGAGGACGAAACCGACGCGTCGCAGA
GGCTTTTGCCAAGACCGGGAAGAGCATTGAGGAACTGGAG
AAGGAGATGTTAAATGGACAAAAGCTTCAGGGACCGTTGA
CTTCTGCTGAGGTCTACCATATCCTCAAACAGAAGGGCCT
GGTGGAGAAGTTCCCCCTGTTCACGGCTGTTTATCAGATC
TGTTTTGAGGACAAACCAGTACGAGACATGATCACCTGTC
TGCAGAGCCATCCAGAGCACTTGTGAGGAAAAAAACCTCA
GTGTCCTCCTGTTAGGTGGTCCTACCTCTAATACTTCTCA
TTTTTACATTGATATACTCATGAATTGTTATACCTTAAAG
GGATAGTTCACCCAAAATTGAGTTTAAGTAATTTTTCCCC
ACTCAGTAGAACATTAAAGTTGAACATCTACTGTTAGTGA
GTCCAAAAAACCTATGCAGGGAAAACAAAAATAATACCCA
TGGTTCTGGACGATACAATGAGGTCTTACTAAGCAAAATG
ATTGGTTTCTGCAAGACATTAGCATTATTACATTTGACTC
CAAATAGATATTTTGAAAAATGTTGAAGTTTGAACAGACG
ATGGTCACCATTGACTGCAAAAGTGTTGAAAAAAATACTA
TGAAAGTTAATTGTGACCATCGTCTGGAAGTGGAAGTATT
TCAGATACTAGTATCTGTATCGGAACAGCTCTCATAAAAG
ACAAATCTAGCTTTTTAGCATTATAGTAAAGTGGTCCTCA
ACTCACGGGGCAGGGACCGGTACTGGTCTGTGGATCAACT
GGTACCGGGCCACACAAGAAATCATTAATTATTTCTGTTT
TTAATCTTTTATTTTGAAAAATGACCATATTCTCGCGGAT
ACATCTTGGTCACTTCAGCGCCAAAATTTAACCCACAATA
GTGACCAGTCGATTTAGTAGTAAACTTCTCATTTAATCCA
TCATAACGAGCCGCAGGTATTAATTTACTGTTACCTGTGT
ATGTTCTTTGACTCTCAAAGTGACAATGGAATTGACTTGC
GTTTTATGAAACACCTTGATTTCAGCTGAAACCAGCTTGA
ATGTTCCACTAAAAATAAAAAAAGATGTGAAGGTTAATAA
ATTGGCAGAGAATTTTCCATTTTGGATGAACTATCCCTTT
AAGCTTTTCTTTTCGTCCAAGGTCTAGGTCTACACTAATG
GTTAGGCTTGAACTCAGGGGTTTGTTTCCAACCCAGCAGC
TTTTGTTATTATTACATGACATTTTTTTAATAGGGGATCA
TGTGTTATTCCATTTAAGCCGTTATGCAGCTTTTAACTGT
TTTCTCTCTGTCTGACTGCCCTCTTGTGGATGATCCACAA
TTAAACCTCACTGACAGACGAGATCAAATGGCTCTTTTTA
AATGACCACTGAGATCTAACTATAAAGACTCGCACTCCAT
GTCCACATCAAGAGCAAAACGACACGACCAGAATGCCTCA
ATTATATTCGACCATCTTGTAGAACCAGCATTATACAACT
TTCCTTAAGAAAACCTGAGAGTTTTTAATACTTAGTTTGA
CCCAAGGGCACAATTTAGGTATAAAACGAAGTAAACTATT
CATATTTTCCATTTTAACGACTGTGTTGATGAATGCTAAA
CTGCCACTTAAAGGGTATTAACACATTAGATTAAAGGAAC
TCATTTTACAACTCCTCCACAGTTAAAACAGTTGAGTTTA
AACATTTATAATTCAGCCAATCTCCGGGTCTGGCTTTTAG
CTTAGCTTAGCATAAAGCATTGAATTAGATTAGACCATTA
GCATCTCATGAAAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations