Transcript

rtn2b-002

ID
ZDB-TSCRIPT-090929-9198
Name
rtn2b-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026531 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026531|OTTDARG00000021011|ZDB-GENE-060331-95 rtn2b|no_translation rtn2b-002 LG_ BX248087.10 Danio rerio protein_coding KNOWN, 538 bp
AAGGTGAGAGTCTTGAGCAGGACTGAACAGCACGGGGAAT
CAAGCTCTCATGAGCTGTATTGTTTACACGTGTAATCTGC
TGGTACACGAATAGCAGGTTGGCAGTAACTGAGTGTTGGA
TCTGATATACTGGCGGAATTTGGCAACCACCGGGGTGGTG
TTTACAGGTTTGGTTGTGGGCTTGGCTTCTTTGTTTCAGC
TCAGTGCCATTACAATTCTATCCAACCTCGGTTTGAGCAT
TATGGCCTTCACCCTCCCTGTACGCTTGCTCTACAAAGCC
ATGACAGTTACCCGTCTCAATGATGGATCGCATCCCTTCC
AGTCATATTTGGATGAGGACCACACGCTGACAGACGAGGA
CACAGTTCGCATGGCGGAACAAATGGTTCTGCTGATTGCA
ACGGCTGTCAGTGAGCTGAAGAGGCTGTTCTTCATCGACA
GCATCATGGACTCAGTGAAGTTTATTGTATTCCTGTATTT
GTTGACCTATGTGGGGGTCCAAGCCAACGGTCTCACGCTG
GTGATGTCTGGTGTGATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations