Transcript

hspa4b-201

ID
ZDB-TSCRIPT-090929-9131
Name
hspa4b-201
Previous Names
  • hspa4-001
  • hspa4b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026457 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026457|OTTDARG00000020963|ZDB-GENE-030131-6018 hspa4b|OTTDARP00000021700 hspa4-001 LG_none CT956101.9,BX470157.7 Danio rerio protein_coding KNOWN, 3010 bp
AACCGGAATTGTTCCTGTTTTCTCCTGAGCGGCGTTTATC
ATCCGCAGCCTCATTCCTCCATGAAGTACAGTAGAATAAT
GAATTAAAACTGTCGTATTTACTCTTCGCATTATACAGAT
TGACCACCTAGTCCTCATTTGATTTCGGGCTTATAGTACT
TGAGTAATCCTGCTATTTTTAAGATGTCGGTGGTGGGTTT
TGACGTGGGTTTTCTCAACTGCTATGTTGCGGTAGCTCGA
GCCGGAGGAATCGAGACTGTGGCCAATGAATACAGCGACC
GATGCACACCAGCATGTGTGTCTTTTGGACCACGAAATCG
GTCTATTGGAGCTGCAGCAAAAAGCCAGATGGTCACCAAC
TGCAAAAACACTGTCCATGGATTCAAGCGTTTTCATGGTC
GGGCTTTCTCAGATCCATTCGTCCAGAACTTGAAGCCTAG
TCTCGTTTATGATCTGGCACAGATGCCATCGGGCACGACG
GGCTTAAAGGTGATGTACATGGAGGAGGAGAAGGTGTTCA
GCATTGAACAAGTCACTGCGATGCTCCTCACCAAACTCAA
GGAGACTGCTGAGAGCGCCCTCAAGAAGCCTGTGGCTGAC
TGTGTCATCTCTGTCCCCTGCTTCTACACCGATGCTGAAA
GGAGATCCGTCATCGATGCAGCTCAGATTGCAGGACTCAA
CTGTCTGAGACTCATGAACGAGACCACTGCAGTGGCTCTG
GCATACGGCATCTACAAGCAGGATCTACCCGCTCCTGAGG
AAAAGCCAAGGAATGTGGTGTTTGTGGATATTGGCCATTC
AGGCTACCAGGTTTCTGTGTGTGCCTTTAATAAAGGCAAG
CTTAAGATTCTTGCTACAGCCTTTGACCCTGAAATGGGAG
GAAAATATTTCGATGAGAGGCTGGTCAAATATTTTTGTGA
GGAGTTTGTCGTGAAGTACAAACTAGATGCGAAGACCAAA
CCCAGAGCTCTGGTCCGGCTCTTCCAGGAATGTGAGAAGC
TGAAGAAGCTGATGAGCGCCAACTCCTCCGACCTGCCGCT
CAACATCGAGTGTTTCATGAATGACGTTGATGTCTCAAGC
AGACTTAACAGGGCTCAGTTTGAAGAGATGTGTGCTGATA
TTTTAGCCCGAGTGGAGCCTCCGTTGCGCAGCCTCCTGGA
ACAAGCTCATCTGAAGAAAGATGACATCCATGCAGTAGAA
ATAGTGGGCGGTGCTTCTAGAATGCCGGCCATCAAAGAGC
GAATCAGCAAGTTCTTTGGGAAAGAGCCGAGCACAACGCT
GAATGCAGATGAAGCTGTGGCCAGAGGATGTGCTCTCCAG
TGTGCAATCCTCTCTCCGGCTTTTAAAGTCCGTGAGTTCT
CGATAACAGAAGTGGTTCCGTTTCCCATCTCTCTTAAATG
GAATTCTGCAGCTGAAGATGGAGTCAGTGACTGTGAGGTT
TTCCCAAAGAACCATGCAGCACCTTTCTCTAAAGTGTTGA
CCTTTTACCGGAGAGAGCCATTTACCTTGGATGCATACTA
CAACTCCCCTAAAGAGCTCCCTTATCCAGATCCCACAATA
GGCCAGTATGTTGTCCAGAAAGTGGTTCCCCAGGCCTCCG
GTGAGAGTTCAAAGGTTAAAGTGAAGGTGCGAGTGAACAT
TCATGGCATCTTTAGTGTTTCCAGTGCTTCACTAGTGGAG
GTGCAGAAATCTGAGGAGGAAGAGGAGAGCATGGAAACCG
AGCAGAGCACAGAAAAAGAAAATGAGAACAAAATGCAGGT
TGATCAAGAGGAACAAAAGACTCCAGAGACGGAACAGGAA
AATGGCGAGAAAAAACCTGGAACTGAGGAAATGGAGACCT
CAGCAGAGGAAGGCAAACAGGAGAAGAAATCAGATCAGCC
TCCCCAAGCCAAGAAGCCCAAGGTGAAGACAAAGGTGCTG
GATTTGCCCATTGAAAACAACCCGCAGTGGCAGCTGGCCA
ACGACATGCTGAATCTGTTCGTGGAGAGTGAGGGTAAGAT
GATCATGCAGGACAAGCTGGAGAAGGAGCGCAATGATGCC
AAGAATTATGTTGAGGAGTATGTGTACGAGATGAGGGACA
AACTGCATGGCATATTCGAGAAGTTCGTCACTGAGAGTGA
CAGAGATGTTCTCTCATTAAAACTAGAAGACACTGAGGTC
TGGCTGTATGAGGATGGAGAAGACCAGCCCAAACAAATAT
ACATCGACAAACTTGCTGAACTGAAGAACCTTGGCCAACC
CATTCAAGACAGATACAGAGAGTTTGAGGAGAGACCCAAA
GCTTTTGAAGAGCTGGGCAGACAGTTGCAGCAATACATGA
AGATTGTTGAGGCCTACAAAACCAAGGAAGAGCAGTATGA
TCATCTGGAGGAGGCAGAAATTCAGAAGGTGGACAAGATG
GTGAATGATGTCATGATCTGGATGAACAGTAAAATGAACC
AGCAGAGTAAACAGAGTCTTGCCATCGAGCCAGTGGTGAA
AACGACAGAGATCCAGGCCAAAACACGGGAGCTGTTTTCT
ACTTGCAATCCAGTCGTGACCAAACCCAAGCCCAAAGTGG
ACTTGCCAAAAGAAGAGAACCCATCAGAACCCAACGGGCC
CGTCAACACACAGGAAAACCCTGAAGCTCAGCCCGGCGGC
ACAGAACCAGCTGCTGCAGACAGTGCAGGAAACACAGAAA
ACAAGCCTGACATGGACCTTGATTAAACACGCTGTGTAAT
GTTATGTTAACGTTACACGTTATGTTATGTAACATAATGT
TTTGTTAATGTTAACTTATGTTTCCAGTGACTAGAATGCT
AAATCATCATCATCATCCTCCTCAAAACAGGGAGACTCTA
ACAGTGAGCGATTCAGTGGCTACATTTGCATGTCGTTTTA
TATTAAGAAAATCATAAGTCATAATGCTGTAAGACTTCTG
ATTGAGAACAATTCTGTCTGCCTACAATTGAGTTTCTGTC
ATATGCCGGTTCTGTCAGCTGTTGTTTCAATAAATATGGA
TTGAAACGTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations