Transcript

selenot2-201

ID
ZDB-TSCRIPT-090929-9073
Name
selenot2-201
Previous Names
  • selt2-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026396 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026396|OTTDARG00000020927|ZDB-GENE-030411-4 selt2|OTTDARP00000046908 selt2-003 LG_ BX004830.7 Danio rerio protein_coding KNOWN, 798 bp
TATTTCCTGAGGGTACAGTAAGGTGTTCCAGGAGTACTCC
CGGTCTATTAGCCAGCTGTACCCGGACATCCGAATCGAGG
GAGATAATTATCCTCCCAAACCTATCAACAAATATCTCGG
AAATTTCCTCTCTTATTTTAAATTGCTTGCCATCGCTTTG
ATTGTGACTGGACAAAATCCTTTCCAAATGTTTGGAATGA
ACACTCCAAGAATATGGGCCTGGGGTCAGGAGAATAAGAT
TTTCTCCTGCCTCATGGCCTTTTTTATTAGTAATATGCTG
GAGACCCATTTCCTCTCAACAGGAGCTTTTGAGATTACAC
TGAATGATATCCCAATTTGGTCCAAGTTGCAATCGGGATA
TGTACCCAACATTCAGGAGCTGTTCCAGATCTTAGATAAC
CACCTTAAGATGAATCAGGCCGACAAGATGAACTTTCCTT
CACCGTAGTGCTGTTGTTTTTGCCAAGAGACATGTGAGTG
GTTAAACCTGTACAATTACATCAGCATGTATGTCACAGCA
AGTACAAGCATAGCAGCTTTTAACAAAGACTTTTTTTGTT
TACGTTGTTTTCGATAGATGTGTTTCCCTCTAGGCTTTTG
AGTTATTTGCAAATCTCAGTTCTTGGCAAAACATTTTTTA
AGCTGAAGTGTTTTTTTAATCATTTTTATTTTGATAGTCG
TATGTTCTGCACTTATTTGATCAATGGCTTTTCAGTAATA
TTAAAATGAATTATCATTAAACATTTCTCATCTTTGAAAA
TGTCAATTAAAAGATTAAAATCATCTGTGCACCTTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations