Transcript

selenot2-203

ID
ZDB-TSCRIPT-090929-9071
Name
selenot2-203
Previous Names
  • selt2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026394 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026394|OTTDARG00000020927|ZDB-GENE-030411-4 selt2|OTTDARP00000021658 selt2-001 LG_ BX004830.7 Danio rerio protein_coding KNOWN, 1650 bp
GTGAAGTACCAGTTCAGCGGCGGCGGCAGCAGCGACAGCA
GCAGCTACAGCGGGTCTGTGGGTTCGGTTTGTGGCTGAGG
ACGGGCCCGGAGATGGCGGAGTACAGTCAGACGGGTATAT
TAACGGCCCTGCTGCTGTTCACAGTGGTGACTGTGAAGGA
TATTTATGTGGGCCGCAACAGCGTGACTCAACAGGAGAAC
ACTGGACCCGACATCAACACACAGCGACAGAATAAACACA
CGTTCTACACGGGACCTGTCCTCAAGTTCCAGTACTGTAT
TTCCTGAGGGTACAGTAAGGTGTTCCAGGAGTACTCCCGG
TCTATTAGCCAGCTGTACCCGGACATCCGAATCGAGGGAG
ATAATTATCCTCCCAAACCTATCAACAAATATCTCGGAAA
TTTCCTCTCTTATTTTAAATTGCTTGCCATCGCTTTGATT
GTGACTGGACAAAATCCTTTCCAAATGTTTGGAATGAACA
CTCCAAGAATATGGGCCTGGGGTCAGGAGAATAAGATTTT
CTCCTGCCTCATGGCCTTTTTTATTAGTAATATGCTGGAG
ACCCATTTCCTCTCAACAGGAGCTTTTGAGATTACACTGA
ATGATATCCCAATTTGGTCCAAGTTGCAATCGGGATATGT
ACCCAACATTCAGGAGCTGTTCCAGATCTTAGATAACCAC
CTTAAGATGAATCAGGCCGACAAGATGAACTTTCCTTCAC
CGTAGTGCTGTTGTTTTTGCCAAGAGACATGTCTCCGGAG
CTGTTTGGCCGGTCAGCGGGACTGTGGACTGTGGCATAAT
GAAGGCCTGCGCTGCAAACAGCACACTGTTGGCACAGGCT
GGATGCTCAGCCACCACACACACTCCTCCTGCCCAGCAAC
ACACACCTCTGGATCGACTGCATCTCTTCAGAGCAACACG
CATTCATAGTAGGAAAGTCTCGCGTGAGCTAAAGGCACTA
CAGTTCTTACTAGATGCTGAAGTTGTGCCACATGCAGATG
TTTTTTTTTTTTATTTTTTATTATTATTTGTGTTGATCAG
GGGTAGCTTTGTAACAAGTGCTTTCAGATGAAATCGAATC
TCAAGGGCAAATGTCATGTTTTATTAACGTATAGGTTTAA
GTCTTAAAATGACCTTTAACAGGGTTATTTGTTTGCACTG
GTGTAGATTGTACTGTACTCGGGGGTTTTTGCCTTTTTAA
TTTAGTGGGAATGCATTTTTCTTTATATGATAATGCTTGA
AATTGTCCATTTTGTTTTGTTGCAGGTTTTTTTAGCTAGA
TTCATAAGTGCAGCATGTGCTTTCGGAGGGAATTAAGGCC
AGATGTTTTTCTTCTGCTTAATCTTTAAGTGTGTATGTAA
GCACTGCCAGGGGAATTTGTGAATGATCTTCAAATGGCTG
CAGTCTTAATGATGGTGTGATTGAGTGATGCTTATTAGAA
GACGTGAATGGTAATTCCAGAGACCCCCTGCTCCTCTATT
TTTCCAGCTCTTTCCATGTAGATGTGGCGGTAAGCAATGT
ACCCTGGTATTTAAGCGTACCTCTGTGAATTTGTTACACG
AGTGATACAGTAGTTGGGATTAAGTTGCATTGAGAGAAGA
CATTTTACTTCATTTCATAGTGATGTAAAATAAATATTGA
CATGTTAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations