Transcript

hacd2-202

ID
ZDB-TSCRIPT-090929-9000
Name
hacd2-202
Previous Names
  • hacd2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026319 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026319|OTTDARG00000020889|ZDB-GENE-030131-6053 hacd2|OTTDARP00000021605 ptplb-002 LG_ CR847515.11 Danio rerio protein_coding KNOWN, 725 bp
ATATTGCATTGTGCCGTGGGAATCGTTCCCTCTTCTGTGG
TCCTGACTGGATTCCAGGTGATGTCACGGGTGTTTCTTAC
TTGGGCAGTGACACACAGTGTTAGAGAATCTCTGGGTGAC
TTAAATCTCTCATTTCAGGTCCAGAGTGAAGACAGTGTTC
TCCTCTTTGTGGTGGCCTGGACAGTCACTGAGATCATCCG
ATACTCTTTCTACACCTTCAGCCTGCTCAACCACCTGCCT
TACCTTATCAAATGGGCAAGGTACACATTTTTTATTGTGC
TGTACCCGATGGGAGTGATGGGGGAACTTTTAACAATCTA
CGCCGCACTGCCATATGTGCAGAAAGCAGGGCTTTACTCC
ATCACCTTGCCTAACAAGTACAACTTCTCATTCGACTACC
ACACGTTCCTCATCTTCGTCATGATCTCCTACATACCCTT
ATTCCCTCAGCTCTACTTCCACATGATGCGCCAGAGGAAG
AAAGTTCTGGGTCACGTGGAGGAGTACAGCAAAGTGGAAT
AACCAAGCGGACTGATTGCACAGAAAGCAGAAACAAGCGG
ACAACCTTTAAAAGCCACACTTCACAGATTCTGGAAAAAA
AATTTAAGAAGAAAAGGCCTCCTTGGCGATTAGAACAGGC
CAGTTATGCAGAACGATTGTTAACAATACTATTTTGGTCA
AGAACTGTAGCAGTTGGTGATTCTTTTTAGGGTTCATGTA
ACTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations