Transcript

hacd2-201

ID
ZDB-TSCRIPT-090929-8999
Name
hacd2-201
Previous Names
  • hacd2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026318 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026318|OTTDARG00000020889|ZDB-GENE-030131-6053 hacd2|OTTDARP00000021604 ptplb-001 LG_ CR847515.11 Danio rerio protein_coding KNOWN, 2129 bp
GGCGCTGGATTCATAAGCAGCTTTTTTACATGTCAGCAAG
GCCACACGCCTTTATCCACCGGGACCATTGGATGATCCAG
TCTTTCTAATGATAGTTCAGTCATGTCGGCACCTGCCATG
GGGACCAGCAAAACAGCGCACAGTGAGTCCGGTCACAAGA
AGAAAAAGGGCCCCGGAACACTGGCCACAGCATATCTGGT
CATTTACAACGTGATTATGACAGCAGGGTGGCTGGTGATC
GCTGTTGGTCTTGTTCGAGCATACCTCGCCAGAGGAAGTT
ATCATGGGCTTTATTACTCCATAGAGAAGCCCCTGAAATT
CTTTCAGACCGGTGCACTGCTTGAGATATTGCATTGTGCC
GTGGGAATCGTTCCCTCTTCTGTGGTCCTGACTGGATTCC
AGGTGATGTCACGGGTGTTTCTTACTTGGGCAGTGACACA
CAGTGTTAGAGAAGTCCAGAGTGAAGACAGTGTTCTCCTC
TTTGTGGTGGCCTGGACAGTCACTGAGATCATCCGATACT
CTTTCTACACCTTCAGCCTGCTCAACCACCTGCCTTACCT
TATCAAATGGGCAAGGTACACATTTTTTATTGTGCTGTAC
CCGATGGGAGTGATGGGGGAACTTTTAACAATCTACGCCG
CACTGCCATATGTGCAGAAAGCAGGGCTTTACTCCATCAC
CTTGCCTAACAAGTACAACTTCTCATTCGACTACCACACG
TTCCTCATCTTCGTCATGATCTCCTACATACCCTTATTCC
CTCAGCTCTACTTCCACATGATGCGCCAGAGGAAGAAAGT
TCTGGGTCACGTGGAGGAGTACAGCAAAGTGGAATAACCA
AGCGGACTGATTGCACAGAAAGCAGAAACAAGCGGACAAC
CTTTAAAAGCCACACTTCACAGATTCTGGAAAAAAAATTT
AAGAAGAAAAGGCCTCCTTGGCGATTAGAACAGGCCAGTT
ATGCAGAACGATTGTTAACAATACTATTTTGGTCAAGAAC
TGTAGCAGTTGGTGATTCTTTTTAGGGTTCATGTAACTTA
CACAAATGGCTTTGCCTCAATTTAGAGGAAGGGGAATGTC
TTTATCATATTAATACATCCGCTACCTTGTGACTTTTTTA
AAAATTAATTCTAAATGTAGAATTACTGACCAAATATTGT
AGCAAGTATCATTCAGAAAAAGGGCAAAACGCAATTAGCT
GCATCTGCTGGCTTTTACCAGAAGAAACGTCCCATGATTC
TCATGTGTAGTGCGTTCTTTACACTGTATTGAATCTAAAT
TGATTTCAATATCTCACTTAGTTCATTCCTTTATACTTTG
AGTGTTTAATGACTCAAGCCGTACTTGACTTTCACACTAC
TAGCGTGTCTACTGATTCCCATTATGATTACTGTTAGTGT
TTTCTTTTGTTTTGTGCTGTGCTTTCCTAAAGGATCAATG
TTAATCGGTTGTTTTATTCAGTATTGGATATATATTGTTG
GTTTGTGGCCGTTTGCGCAGAAAAAGAGGTGAATAACCCA
AAGAAATCCTCCGAGTTGCTGGGTCGGATCTACAGTCAAT
GCTACTAATGTACTAGATGTGCATTTCTGTCGTAAAAAAA
AAAAAAAAAAAAGAGGAAACTCCTGACACTTTTGGAGCTT
GTGAGGAGAGCTACAGGAGCCAATTGGATTCGAGTGCCTC
CAGTCATGCTTTTCCAATGAGTCAAATCTAATAATGTGGA
GGAAAAACCTGAGAGTTGAGATTTTTAATGCTTCATTGCG
CGTCTGCCTAATTGTGAACCGCCAACTTCAGCCCCCCTGC
CCCCCTCTCAATGCAAATGAATCCCATATATAATGAAGTG
CGAGCCACACTATTGCACAGATAGAGTCTTTTGGTAAGCC
TGTTCATGACGAATTAGCATGGGATGCTGAATGAATGCTT
GTGAAAAGCTGGAGTGCAACTTTAAATAACACTGCATGTC
CAAGTGCTGTGGCTAGACCTTGGTTTGTTGAAGCATGACC
CTTAACTCGATCTAAAACGCCAACATTGTCAAGCTTTTGA
TATTAAAGATCTGCATGGGACCAGCAAACTTTGTATGAAT
AGTAATACAATGATATATATTTACAATAAACCATGACATG
GGAAGCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations