Transcript

noto-201

ID
ZDB-TSCRIPT-090929-8795
Name
noto-201
Previous Names
  • flh-001
  • noto-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026102 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026102|OTTDARG00000020758|ZDB-GENE-990415-75 noto|OTTDARP00000021436 flh-001 LG_ BX571943.9 Danio rerio protein_coding KNOWN, 991 bp
TCGAGAACTTCGAAGGATATCTTTTTTTTTTTTTAGTTGC
TTTTTGGACTAAACAGACGCCATGCAGATTCCCGGAAGAG
CTTACGAAACTTATGGACAATCAGCACGTCCTTTGCATCA
GGACTATGCCACCTCTTCTTCAAAACCGAGCACCGGGAAA
TCATTCACCATAGACGCTCTGCTCGCGAGGCCTGACCAGG
CGGAGATGAGAGAACGAACAAACGCGTACCGGAGCATAAC
CAACCAAACGTCTGTCTCCAGCTCTGCGCTCCCGCTTATT
TACTCGCAGATGCCACACTTCGCGTACAGCCAAAGCATCA
TGCAAACTCAGACAGGCTATCCCGTGTTCTGCTATCCGCC
CTACAACTTCCAAACAACATGTCGTGGAGCTGTGTACGCA
CAAGATGCAGTACTGGCGAAAGCAGCAGTTCATTCTCATT
ATAAACACAAATCTGGGAAATCAAAGCGAATGCGTACAAG
TTTTACCAACGATCAGCTGTCCAGACTGGAGAAAGAGTTC
GCGCGGCAGCAATACATGGTGGGATCTGAACGCTTTCTGT
TGGCATCTGCTCTCCAACTCACTGAAGCTCAGGTTAAAGT
CTGGTTCCAGAACAGGCGCATCAAATGGAGAAAGCAGAGT
CTTGAGCAACAACAAGCCAAACTTGCCAAACTGGGACTGA
CCGTTCCACCAAAAAGCCCTGGATCCCAGGGCAGAGAGGA
TGAGGAGAGGGATTTCACAGAAGAGTCTGATGTAGACATT
GACATTGACGATTCACTGCAAGACTGAGACTTTCTCACAT
TGTGTTTTTGTACATACTTTTCCATGATTTTCCCCAGATT
GTTACTCCTCTCTATTTGTACAAATATTTAATTAATAGAA
ATATATTTAAGGCGTCACTTACACACGCCATTGCTCTTAT
AAGGGTATCTTTGTTTTTTGTCAAAATGTTTGAATATAGA
TGAAATAAAGGACATATATTTTTAAAATCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations