Transcript

hells-201

ID
ZDB-TSCRIPT-090929-8655
Name
hells-201
Previous Names
  • hells-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025955 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025955|OTTDARG00000020679|ZDB-GENE-030131-9923 hells|OTTDARP00000021323 hells-001 LG_ AL935288.9 Danio rerio protein_coding KNOWN, 3287 bp
CGTTTCACGTTACACACGCGAGGTGGTGTATCTACCGGCT
GTGTGACGCAAATTCAGCTGCTTTTAATAGAGTGCTTTTA
TAAATCTATATTTTGCAAAACCGGGTGAAGTTAAAGTACA
TTAATGCATTAATTTGCATTGCGTTCTGCTGTTACGAAAC
GGTCCCGCGCTTTTGTTGTGTAAGGCTTTGTTGTATGTTA
GCTAATCGGGTCATTAGTGAGACATTCTTGCTTTACACAC
TGGACTGCATTGCACATATTTGGTAAGGTTCGAGAGATTT
AATTCAGCACCCAGCTACCCTTATAGCAGCTGAAATGAGT
GGGATTGTCAAAGAAGAGACTCGTAGTATTTCTCCCCACT
GCCCCAAACCTAACGAATCTGAAGAGCCTGAAGGCACTAC
AATTGAGGAGACCACAATGGAAAAAAGCAAGCATGAAGAG
ATGGTCATTACCAAAGAGATGGAGGAAGAAGAAAAGAATC
TAGAAGAGGAGGGAGAGAAAAAAGAAAGAGAAATGATGGA
GGAGGCCAGACAATCCAGGGGGAACGATTCTCAAGAAATG
CGGTTCAAAAGACTTCAGCACCTTTTGGAGAAAAGCAACA
TTTACTCAAAGTTTCTTCTTACAAAGATGGAGCAGCAGCA
GCAAGAGGAAAAACTTAAAAAGGAGAGACTGGAAAAGAAA
GCTGCTGTTCTGAAGCAAAAGGGCAGTGATAAAAAGACTG
TAAAAGTTGAGAGAAAGAAGCGTGGAAGGGAAGATTACAA
AATTGCAGATGTGATGACAAAAGAGGAAATTATGTCAAAA
GCCAAAAAGCCCAAAATGGAAGAGGAGGCTCAAGCATCAG
TAAAACTGGAGGCTGAGGATATAGAGAAGCTAAGTGACAC
AAACTCTGATATTAAAGGTCGACTCTCTGAGACTTTAAGG
GAGAACAGCAAGCAGATGCTGGATCCAGAAAGAACGGTGA
ATGGTCAACCTGTGCCAGCACAGCAGCCCCAACTGTTTAC
TGGGGGTGTGATGAGGTGGTACCAGGTGGAAGGCATAGAG
TGGCTCAGGATGCTGTGGGAAAATGGCATCAACGGCATCC
TGGCTGATGAGATGGGTCTTGGAAAAACCATCCAGTGCAT
CGCACATATTGCAATGATGGTTGAGAAAAAGGTCCTTGGG
CCCTTCTTAGTGGTGGCTCCTTTGTCCACTCTTCCAAACT
GGATTTCAGAATTCAAGCGTTTCACTCCAGAGGTGTCTGT
CCTGCTGTATCATGGACCTCAAAAAGAGAGGTTGGACCTG
GTGAAAAAGATCCGTCAGCACCAGGGATCCCTCAGAATGT
GCCCTGTTGTTGTTACATCCTTTGAAATAGCCATGAGAGA
CCGGAAGTTTCTTCAGCGTTTCCACTGGAACTATCTGATT
GTGGATGAGGGTCACAGGATTAAAAACTTGAACTGTCGTC
TGGTGCAAGAACTGAAGATGCTGCCGACTGACAATAAATT
GCTCCTGACAGGAACCCCCCTCCAGAATAACCTGTCTGAG
CTGTGGTCACTCCTCAATTTCCTCCTTCCTGATGTGTTTG
ATGACCTGAAGAGTTTTGAATCCTGGTTTGACATCAGCAC
CATCACTTCAGATGCTGAAAATATTGTGGCTAACGAGCGA
GAGCAGAATATTCTTCACATGCTTCATCAGATCCTCACGC
CCTTCCTTCTGAGAAGATTAAAATCAGACGTCACACTGGA
GGTTCCACCTAAGAAAGAGATTGTTGTGTATGCACCCCTA
ACCAACAAACAAGAGGCTTTTTACATGGCCATTGTTAACA
AGACTATTGCCAAACTGCTGGGTCAGGAGAAGGATGAATC
GGCGCCTGCTCCCCTAACACCCAGTGGCCGACCAAAACGC
AGGAGCAGGAAGGTGGTGAACTATACAGAGCCAAACACTG
ACTCTATGAAAGATCTTGAGAAGTACCTAGAGAAGGTTCA
GCAGGAGTTGGACAGTCAGGCAAGCTCTACTCCTGTGGTG
AATGTGTTTATGCCAGTTGATGCTCAAGTCAACTTGAAAC
TGCAGAACATCCTGATGCTGCTGAAGAGATGTTGCAATCA
TGCGTACCTCATAGAGTATCCTCTGGACCCCACAACTGGA
GACTTTAAGATTGATGAACAGTTAGTGGAAGCCTCAGGGA
AATTTCTTATTCTGGACAGAATGCTTCCTGAACTGAAAAA
AAGAGGACACAAGGTGCTGATTTTTAGCCAGATGACCTCC
ATATTGGATATTCTGATGGATTACTGTTATCTCAGGGGTT
ACGAATACAGCAGACTGGATGGGTCAATGAGTTACGCTGA
CCGTGATGAGAATATGAAGAAGTTTTCTTCAGATCCAGAG
GTGTTTCTTTTTCTCCTGAGCACTCGAGCTGGTGGCCTTG
GAATCAACCTGACATCTGCTGACACGGTCATCATATTTGA
CAGTGATTGGAATCCTCAGGCAGATTTGCAGGCACAGGAT
CGCTGTCACCGTATTGGGCAAACAAAGCCTGTGGTGGTCT
ACCGTCTCATTACGGCCAACACCATTGATGAGAAGATTCT
GGAGAGAGCTTCTGCCAAGAGAAAGCTAGAAAAGATGGTC
ATTCACAAAAACAAGTTTAAAGGCTCTAAAGCAGAACTAA
AACAAAGCAAGAGCTGCTTGGATGTTGATGAGCTTGTAGA
ACTACTGAAGTCCAGAGACTACGACGGGGCAGTGAAAGGC
ACTAAAGGAAAGGTCATCAGCGACAAAGATCTGCAGATCT
TGCTGGACCGCAGTGATTTAATGGATCAAGCCAAGAAGCG
TGTTAAACAGGAGAAAGATGGGGTGTTTAAAGTTATTGAG
GCCAAGGATGACAATGGTGAGATCAGTCTGTCCTGAAAGC
GTTAACGCTTGCCTTTAGGTCAAAGTTGAGTTATTACCAC
TGAAGAAGGGTTAACACTGCTTGATCAGTTTTGGCAAAGT
CCACTGCCTGAATACTGAAAGATTAAGACCTTTTCCATTT
TAGACTATTGTCAAGCACTGCTGCTTTTAGTCAGTTCATC
CTTGGTTTGAGTTTATTTTTTAGCAGTTTTAATATTTCTC
ATGCCAACTTTTCTGGGAGGAATTAGCACTAAAACACATC
CCTACACTTTGGCCTCTTTGTAAATACTGTTGTAGATGTC
ATGTGTAGTTGACTGGACAGGATTCACACATGTAAACTGC
TTCTAAGCACCTTGACCTAGAATACTGTAGAGCAAATATA
TCGTTTTGTTTTTCATGTTTTCAAAATAAATATTTTGTAT
TCTGCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations