header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8648
Transcript Name: six3a-201
Previous Name: six3a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025948 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025948|OTTDARG00000020674|ZDB-GENE-990415-127 six3a|OTTDARP00000021318 six3a-001 LG_ BX537274.3 Danio rerio protein_coding KNOWN, 1889 bp
ATTTAGGGGGAGATATTATGAGGCTGGTGTCATTAGGCGA
TAGCTATTGAATCATTCAATCTGAATTCGTCGTTCTTTTT
TCCTTCGCAAATTTCACTCTCTCTCAGGTCATTTCCATGG
TTTTCAGATCGCCTTTAGAGCTTTATCCCTCTCATTTCTT
CCTGCCAAACTTTGCTGATCGCCCTTTGCTCTTGGCGAGC
AGTGCGCCCAGCACCAGGTCTCCCGAAGACTTGTCAATGT
TTCAGCTACCGACCCTAAACTTCTCTCCAGAGCAAGTGGC
GAGCGTCTGCGAGACGCTGGAGGAGACCGGGGACATCGAG
CGGCTGGGTCGCTTCCTATGGTCGCTTCCAGTGGCACCGG
GTGCTTGCGAGGCGATCAACAAGCATGAATCCATCCTACG
CGCCCGGGCTGTTGTCGCCTTTCACACCGGCAATTTTCGC
GATCTCTACCACATTTTGGAGAACCACAAGTTTACCAAGG
ACTCGCATGGTAAACTACAAGCGATGTGGCTAGAGGCTCA
CTATCAGGAGGCCGAGAAACTACGCGGGCGTCCCCTAGGA
CCGGTTGATAAGTACAGGGTGCGAAAGAAGTTTCCCCTGC
CTAGAACCATCTGGGACGGTGAGCAGAAGACGCATTGTTT
CAAGGAGCGAACGCGGAGTCTGTTACGAGAGTGGTACCTT
CAGGACCCCTACCCAAACCCCAGCAAGAAAAGGGAACTGG
CTCAAGCCACTGGACTCACTCCTACACAGGTCGGAAATTG
GTTTAAAAACAGGAGACAACGAGACAGGGCAGCGGCAGCA
AAAAACAGGCTCCAGCATCAAGCAATAGGGCAGAATGGCA
TGCGGTCCCTTTCAGAATCCGGCTGCACCCCACGGAGTTC
GGCGGAGTCGCCATCAACTGCGGCTAGTCCAACAACCAGT
GTCTCGAGTATGACAGAACGAGTCGACACGGGCACGTCAA
TTCTTTCAGTAACATCAAGTGACTCGGAATGCGACGTATG
ATACGCACACAGAGAAATATATAAAGGAGAATGGACCTGA
AAAACTTTATTAATTATCGGGGAAGATGAAAAAGGACCAA
TTGATATTACTATTATAAAAAGAAAAGCATAAAAGCACGT
CTTTTTTCAAGCGCTTTCAATGGACCCCACACCTTTCCCC
CACCCCACCACTTGCATGATATATATATATCTAAATATAT
TTTTTCTCATTTTTGTATATGGGGAAATGCCCCACGTTAT
TATGTCTACCAGGACCACCGTGAAGAGGGAATTACCAGAA
AGCGGTGTCCAACGCCTTTTTTTCTGTTTTAGTCCGAGTG
ACGACGAGCAGCCAGGATGCAATCCTTTTTTTCTTTTATG
TTCATCAGACAATCATTTGAGTCGTAAGCACCTTTTTACT
ACACTTCTGTCACTGCCTGTGTGGGGTACTGGTCAAATGT
GGAACTGAATCGTTATGACTGTATCAGATTTTTATTTTTA
TTTCGAGATTTTATATTGAATTATGTATATCTTAAATAAT
GCGATCATTCTCCCAGTCTGTAATATATGTGTAGAAATAC
GTCTGTAAATAATATTGCTATTCCCATTCTCTTTTCTATC
CCTGTTCACTTTTCTTGGCTTGGTGTCCCTACATAAACTA
TTCGTCAAAACGTAACTATTAAGTGCTAGGCGTTTTGTTT
CTCTGTTTTATGCCATGAAAAGAACGCTAGTGACTATGAA
ATATCAGTCGAGATTAATGCAAAAGAAAATATTGGATATC
ATCATCGACTGACCAAGTCTACTTCATGTTTCCAGTCCAG
CGCTTATAATTCAATACTACTTTCTTGCGTGTTTCTGTTA
ATGTATACGTTTCTAAACTGAAAATACAGTATTCAATTTT
GTTATAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
six3a-201 Contained in:
[BAC] DKEY-103L3 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000025948 (1),  Ensembl_Trans:ENSDART00000080808 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AF030280 (1) 1914 bp
GenBank:BC059414 (1) 1892 bp
GenBank:BG305412 (1) 504 bp
GenBank:AI629223 (1) 441 bp
CITATIONS (2)