Transcript

crygs4-002

ID
ZDB-TSCRIPT-090929-8485
Name
crygs4-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025769 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025769|OTTDARG00000020561|ZDB-GENE-050223-2 crygs4|no_translation crygs4-002 LG_ BX545855.16 Danio rerio protein_coding KNOWN, 677 bp
GGCTACTGAGAGTGTAAGTGCCTCTGTCTCCCTTACTGTC
CCTCATTCTCACACAATGTTTTTGCACCATTTAACTGCCA
GTGATGTTTTTTTCAGATTGTGTTCTACGAAGACAGGAAC
TTCCAGGGAAGATCCTATGAGTGCAAGGGAGACACAAGTG
ACCTTCATTCTTTTTTTAGCCGCTGCAATTCTGCAAGGGT
AAAAGGGGGCTTTTGGGTCCTGTATGAGCGGCCAAACTAT
ATGGGTTATCAGTATATTCTGGGTCCAGGAGAATATCCAG
ATTATCAACATTGGATTGGCTTCAACGATTGTGTCCGATC
TTGTCGTCTAGTCAGGCATGTAATTGGAGATCTGAAGCTC
AAACTCTTTGAGAGGCCCAACTTTGATGGACAAACATGGG
AAGTGACAGAAAGCACCCCGTCCATTCAGGAACGTTTCCT
CTGCCGAGAGATCAATTCCTGCAAAGTTCATGAAGCTCCG
TGCGTGTTCTTCGAGCATGCAAACTACCGTGGCCGTCAGT
ACTTCCTTGAGAAGGGAGAGTACAGACGACACACTGAATG
GGGGGCCATGCATCCCACTGTGGGCTCTATTCGCCAGATC
ACCACAGACTGATAAATTGAAAATTGCTCACTAATACTAC
TGAAAAGCTTTAAAAAATAAACATATTTGAAGAGGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations