Transcript

crygs4-201

ID
ZDB-TSCRIPT-090929-8484
Name
crygs4-201
Previous Names
  • crygs4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025768 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025768|OTTDARG00000020561|ZDB-GENE-050223-2 crygs4|OTTDARP00000021186 crygs4-001 LG_ BX545855.16 Danio rerio protein_coding KNOWN, 637 bp
AAATAGACTACAGCACAGTTTGCCATCCAACATTTCTGAC
AATGGCTACTGAGAGTATTGTGTTCTACGAAGACAGGAAC
TTCCAGGGAAGATCCTATGAGTGCAAGGGAGACACAAGTG
ACCTTCATTCTTTTTTTAGCCGCTGCAATTCTGCAAGGGT
AAAAGGGGGCTTTTGGGTCCTGTATGAGCGGCCAAACTAT
ATGGGTTATCAGTATATTCTGGGTCCAGGAGAATATCCAG
ATTATCAACATTGGATTGGCTTCAACGATTGTGTCCGATC
TTGTCGTCTAGTCAGGCATGTAATTGGAGATCTGAAGCTC
AAACTCTTTGAGAGGCCCAACTTTGATGGACAAACATGGG
AAGTGACAGAAAGCACCCCGTCCATTCAGGAACGTTTCCT
CTGCCGAGAGATCAATTCCTGCAAAGTTCATGAAGCTCCG
TGCGTGTTCTTCGAGCATGCAAACTACCGTGGCCGTCAGT
ACTTCCTTGAGAAGGGAGAGTACAGACGACACACTGAATG
GGGGGCCATGCATCCCACTGTGGGCTCTATTCGCCAGATC
ACCACAGACTGATAAATTGAAAATTGCTCACTAATACTAC
TGAAAAGCTTTAAAAAATAAACATATTTGAAGAGGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations