header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8458
Transcript Name: ctslb-201
Previous Names: ctsl1b-001, ctslb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025742 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025742|OTTDARG00000020540|ZDB-GENE-980526-285 ctslb|OTTDARP00000021162 ctslb-001 LG_ BX465840.13 Danio rerio protein_coding KNOWN, 1351 bp
AGCCAATAAGAGACCGCCTCTATGTTCGGACAGGCTATAA
AACACACTCAATTGTATGGAATTACAGTCAGTAAGGTTTG
CTTGTGAAAGTCCTCCAGGCAGGATGATGTTTGCTTTGCT
CGTCACGCTGTACATAAGTGCAGTGTTTGCTGCTCCATCT
ATAGACATCCAGTTAGATGACCACTGGAACTCCTGGAAGA
GCCAGCATGGAAAAAGCTATCATGAGGACGTAGAGGTCGG
GAGGAGAATGATTTGGGAGGAGAACTTGAGAAAAATTGAG
CAACACAACTTTGAGTATTCCTATGGAAATCACACCTTTA
AAATGGGAATGAATCAATTTGGTGACATGACAAATGAGGA
GTTCAGACAGGCAATGAATGGTTATACGCATGACCCCAAC
CAGACGTCACAGGGCCCGTTGTTCATGGAACCGAGCTTTT
TTGCAGCCCCACAACAGGTTGACTGGAGACAGAGGGGCTA
TGTTACTCCTGTCAAAGACCAGAAACAATGTGGATCTTGC
TGGTCTTTCAGTTCAACGGGTGCCTTGGAAGGTCAGCTCT
TCCGTAAAACTGGAAAGCTGATTTCTATGAGTGAGCAAAA
CTTGGTGGACTGTTCCAGACCACAGGGCAATCAAGGGTGT
AATGGAGGCCTCATGGACCAGGCCTTCCAGTATGTTAAAG
AAAACAAGGGGCTGGATTCTGAGCAGTCATACCCTTATCT
TGCAAGGGATGATCTGCCATGCCGGTATGACCCCCGTTTT
AATGTCGCTAAAATCACCGGATTCGTGGACATTCCCAGCG
GTAATGAGCTTGCCCTAATGAATGCTGTTGCTGCTGTGGG
TCCTGTATCTGTTGCTATTGACGCATCACATCAATCCCTA
CAGTTCTATCAGTCTGGCATCTATTATGAGAGAGCATGTA
GCAGTAGTCGACTTGATCATGCAGTCTTGGTGGTTGGCTA
TGGTTATCAGGGTGCTGATGTTGCTGGGAATAGATACTGG
ATTGTGAAGAACAGCTGGTCTGACAAATGGGGTGACAAAG
GCTACATCTACATGGCAAAAGACAAAAACAATCACTGTGG
CGTTGCGACAAAGGCCAGCTATCCCCTAATGTAAGGTCAC
TGGAGCCTTCTCTGCATTCTGAAAAAGACACGTTTATGGT
TTCTCTATTTTAATGTGTTTTTATTTCTTCTATTTTATCA
AGTTGTTCTGCTGTTAGGGCTATGATAGTGGTATTTTAGG
AAATTCCATTTTTCTTGTGTTTCATATATTTTGTTTATCC
AAGAAGAAGAATTTTGTACTGGATCTATTTGACCTGCAAA
TGGATAAATAATAAATTTTCTGGCATGGCAA

ctslb TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ctslb-201 1351
ctslb-203 (1) 1289
si:dkey-26g8.4-201 (1) 1348
si:dkey-26g8.4-202 (1) 308
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ctslb-201 Contained in:

OTHER ctslb-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025742 (1)
  • Ensembl_Trans:ENSDART00000145570 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC108031 (1) 1320 bp
    GenBank:CK666854 (1) 441 bp
    GenBank:CB355081 (1) 244 bp
    CITATIONS (2)