Transcript

nkx2.2a-202

ID
ZDB-TSCRIPT-090929-8450
Name
nkx2.2a-202
Previous Names
  • nkx2.2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025733 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025733|OTTDARG00000020535|ZDB-GENE-980526-403 nkx2.2a|OTTDARP00000021156 nkx2.2a-001 LG_ BX927409.14 Danio rerio protein_coding KNOWN, 1730 bp
GAGACCAACCTTATATGGACTGATCAGTCTGGTAATGGCT
TATTTCCCCCTAACACCCAGCAGTAGCGCAATATCCATGA
GCTAGATATACCACTTCAGTCACTTTGGCATTCTTCCTGG
ACTTACTAGAACTGATTTTTCCGCTACTTTTTTCCCCAAG
CAACGGTTACCGACCGAGCCTCATGCGTCGACTTCAGTTT
ACTTCGCGCTGAAACGGCACTAATCCTGCATGCATTAAAT
CATCGGTGTTTTTGTGTTTTTAAACAGAGGATTGTCAAAC
TGGTGCAGCAACTTGACTGCATCAAATGCTCCAGAACATG
TCGTTGACCAACACAAAGACGGGCTTTTCAGTAAAGGACA
TTTTGGACCTCCCTGATACTAACGATGAAGAAGGATCTAT
CACCGGCACCGAGGAAGATACGGAGGGTTCTGAGGCGACT
AAAACGCCTGGAGTGTTAGTGCAAAGTCCTTTAGAGAATG
TTCAAAACCTGCCTTTAAAGAATCCATTTTATGATAATAG
CGACAATCCTTATACTAGATGGCTCGCAACCACGGACAGC
ATCCAATACTCATTACACGGCCTGTCCGCGAACTCTCAAG
ACACGTCCGCAAAATCTCCGGAACCTTCAGCTGATGAATC
GCCGGACAATGACAAGGAAACTTCAAGCAACGGCAGCGAC
TCTGGTAAGAAGCGCAAAAGGAGGGTGCTCTTTTCCAAGG
CACAAACTTACGAACTCGAGCGCCGGTTTAGGCAACAGAG
ATATCTGTCAGCCCCGGAGAGGGAGCATCTCGCCAGTTTG
ATTCGCCTGACTCCAACCCAAGTGAAAATCTGGTTCCAGA
ACCACCGATATAAAATGAAGAGAGCCCGGGCGGAGAAAGG
TATGGAAGTGACCCATCTCCCTTCTCCTAGGCGGGTGGCC
GTGCCAGTGTTAGTCAGAGACGGCAAACCTTGCCATACGC
TAAAAGCTCAGGACTTGGCAGCTACTTTTCAGGCTGGAAT
TCCGTTCTCTGCGTATAGCGCCCAGTCTCTCCAGCACATG
CAATATAACGCGCATTACAGCGCCGCCACTACACCACAGT
TCCCAACAGCACATCACTTGGTGCAAACGCAACAGTGGAC
TTGGTGAACAAATACTGACTTGCAATGCAGGGTTGCATTT
TAAAGACCGTGGTAGGGAGCTTTCCAAACAAAAAATACAA
GACTTTTTATTTTTGCAGCTTGACCCTTTCTCACCAATTT
ATTTTGGGGATTGACGTGTGCGCCATGTTTACATGTTTTC
GTTTAGAAAACCGGGTCAAGCCTCTCCCCAAATTTAAGAA
TGTTAAAGCTCTTGTGAAATTTTGTAAAGTATGTTTGTGT
GTTGTAGAAATGTTTTTCTTTTGTCCTTCGTGTTATACGC
ACGTGCAAAACCACTTTATGATTATAGAAAATTTTATTTC
TTTCTTTTACAATGGACCGAATATATTTATGGCCATGAAT
AAACACTGGCAATCCTTAGCTTATTTCATTGGTTTGTTTT
ATATGTAAATATTTTGTGATAACTGTTTGCAATATTATGT
TTGACCGTCCAGTAAGCTATATCCTAAATATATGCCATAT
TTAGGGAAGATGGAACATCATTGTCGACAATATCCCTTCT
GTTAATTTCAGCAGGTAACAACGCGCGCTGGCGAGGGAAG
TCTACAGTTCTTTTTATTAAAACTTTTAATAAAATTATGT
GTTTCAGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations