Transcript

dkk1b-201

ID
ZDB-TSCRIPT-090929-8410
Name
dkk1b-201
Previous Names
  • dkk1-001
  • dkk1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025692 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025692|OTTDARG00000020510|ZDB-GENE-990708-5 dkk1b|OTTDARP00000021119 dkk1-001 LG_ BX649533.5 Danio rerio protein_coding KNOWN, 894 bp
GGAACCACAGAAGAGCTCCGCTCACCCAGGGAATACATCC
TACAATTCAAGGAATAACATGATGCACATCGCCATGCTCT
CTACTGCATGCCTCATTTTTATGGGCTGCATCAAAGTGGC
CGGTTCTACGATGCTCAACTCCAACGCTATTAAAGTCGGT
TCAGGTGCGGCGGGTGCCAGTCATCCGGTTAGCCCGAGTC
CGGACGTGTCACTTTTGGACAGTCTGAACTTCGCCCTCGA
TACACCGCAGCAGCCTTTAATCTGTGAGAGTGATGAGGAA
TGCGGTGGAGAGGAGTTTTGCTTCCAGTCTCGCGGTGTCT
GTCTCCAGTGCAAGAAGCGCAGGAAGCGCTGCATCCGGGA
TGCGATGTGCTGCCCTGGCAACCACTGCAGCAATGGTGTT
TGCATTCCAAATGACCCTGACATGATTCAGCAGCTTGGCA
TGGAAGAGTTCGTGTCCATCGCCCATGAAAACTCTACTGC
TCTAATGCCGAAAGTTTCGACTCAAGGATCACCACAAAAC
CAGATGCTGAAAGGTCTGGAGGGAGAGAACTGTCTGAGAT
CATCAGATTGTGCAGAGGGACTTTGCTGCGCTCGTCACTT
TTGGTCCAAAATCTGCAAGCCTGTCCTAAAAGAGGGCCAG
GTCTGCACCAAGCACAAGAGGAAAGGCACTCATGGCTTGG
AGATATTCCAGCGCTGCGACTGCGGGGAAGGCCTGTCCTG
CAGAACGCAGCGAGGAGACGGCGGCAAGGCTTCACGGAGT
CTGCACACATGCCAGAGACACTAAATGAAAATTCAAGGAA
TTTTCTTTCACCAGCTCCCAGAGAAGCAGACTTGAGTCGA
GGGAAGCAGGACTTGGAATGGGATACTCTGTTTTTCAACT
GGTTTCCTTCATAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations