ZFIN ID: ZDB-TSCRIPT-090929-8387
Transcript Name: sap18-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025668 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025668|OTTDARG00000020497|ZDB-GENE-040426-1679 sap18|no_translation sap18-002 LG_ BX511129.15 Danio rerio protein_coding KNOWN, 1714 bp
GCGATCGAGCGTTTACTGGCGTCGTGAACAGCGACTCATC
GCTTATTCTTTCAACAAATAAGATAAAAATGGCTGTGGAA
TCGAGGGTCACACAGGAGGAGATCAAAAAAGAGCCAACAA
AGCCAGTGGATAGAGAAAAGGTTTGTTTTCAGTTACTTCT
GTTCGTCAGTGGCGCGAATATTCGTGCACAAACGAGGCGT
CCTGCATGCTAAGCTAATTTGTAAATCTAACGCTAACTAA
AAATGTAGGTACACAGAAACATTACAAAATATCTAGTTGC
AACGTTATACTACAAATCGTATCTTAAACCGTGTGCATTC
CTTTTAGACATTTGGCCTTTTTGTTTTATTTTGTACTCAT
TTTATCTGTTAATGTAGCATAGCGTACATTCTGGCAAATA
AAAAGTTGCTTTTATTAAGCTTTTAATATATTTTACCCAT
TTTCTTATCAAGATTCTGTTTTGGACTGGTAAAAAAACGT
CGACTAATATTTAACCATCCCAGTGCCATTTAAGTAAAAA
GTCACATACTCTTTGTTAACAGGCTTCCATTTAAAAACGC
AATTATATAAAAAATGTTTAACATTATATTTTTGGCACAT
TTCTTCAGTTTTGTTTTGGAGTAAAATTGAGCATGTTTTC
ATTTCAGGCCAAATGAACTAAAGTAATACAAATGTTGTTC
TGATCGTCGACTTAAAGACAAATAACCTCTAAAAATCTGC
ACAGAAAAGTATATTTCTCATAAATCAATTTAGTGTTAAA
ACTACTTTTGTAGTTATTATCAGAATTGATGTTGGTTAAG
AAATGAGATTACATCTGCACCAGTGGTTAGTGCGTCAACA
CATGCACTTCGGTGACCCGAGTTTGATTCCTGCCTAACGA
TCCTGTGCCAACTGTTTAATAACCATTATATTGGATGCAC
AGACACATCTGCATGTCTGATTGTTTTAAAAGACATTGTT
ATTAATACTTTCTACATGTGTTTGTTGTGCTCGTTGTGCA
GACATGCCCACTTCTCCTGAGAGTGTTCACCACCAACAAT
GGAAGGCACCATCGCATGGATGAGTTTGCCCGGGGGAACG
TGCCCTCTAGTGAACTTCAGATTTACACCTGGATGGATGC
TACTCTAAAAGAACTGACAAGCCTGGTGAAGGAAGTCTAT
CCGGAAGCTCGGAAGAAAGGCACACATTTTGGATTCGCCA
TTGTTTACCCAGACCCCAAACGACAAATCTACCGGGTTAA
AGAAATTGGCAACACAGTTTCTGGGCGCAAAGGTGCAGAT
GACTCGATGACGCTTCAGTCACAAAGCTTTCAGATCGGAG
ATTATCTTGACATTGCCATCACTCCGCCTAACCGCGCACC
GCCTCTCCAAGGACGCATGAGGCCCTACTGACCTGAAACA
ACACTTGACTGCATTTAAATGAAAGGGGTGAAGTCTGTCT
TCCTGCAGAGTTTAGTTCAGCCCTTGTCTGAGCTTTTCAG
GTGAACTGCAAGACTTTGATTTGATCGAGTGTTTATGTCG
GAACTAAACTCTGCAGGAAGGTTTATGCAGAATAGCAGCA
TGATTGAGCTGATAATCTCGATTTGGAAGTAAAAAGGAAA
GTCTTTTCATATATTATGTTCTTTGTGGAGTTTTTTATCA
GATCTACCTTTTTAGTTCTAGTCCTGTTAGCGTGATTCAA
ATCATTCATGAATAAATGTTTTTTTTTTTCAGTA

sap18 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA sap18-201 (1)    Ensembl 875
ncRNA sap18-002 1714
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sap18-002 Contained in:
[BAC] RP71-68N21 (1)

Genome Resources: Vega_Trans:OTTDART00000025668 (1),  Ensembl_Trans:ENSDART00000145240 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC090729 (1) 1745 bp
CITATIONS (2)