header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8386
Transcript Name: sap18-201
Previous Name: sap18-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025667 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025667|OTTDARG00000020497|ZDB-GENE-040426-1679 sap18|OTTDARP00000021099 sap18-001 LG_ BX511129.15 Danio rerio protein_coding KNOWN, 875 bp
GATGATATCATCTCACCGCGCCGCGATCGAGCGTTTACTG
GCGTCGTGAACAGCGACTCATCGCTTATTCTTTCAACAAA
TAAGATAAAAATGGCTGTGGAATCGAGGGTCACACAGGAG
GAGATCAAAAAAGAGCCAACAAAGCCAGTGGATAGAGAAA
AGACATGCCCACTTCTCCTGAGAGTGTTCACCACCAACAA
TGGAAGGCACCATCGCATGGATGAGTTTGCCCGGGGGAAC
GTGCCCTCTAGTGAACTTCAGATTTACACCTGGATGGATG
CTACTCTAAAAGAACTGACAAGCCTGGTGAAGGAAGTCTA
TCCGGAAGCTCGGAAGAAAGGCACACATTTTGGATTCGCC
ATTGTTTACCCAGACCCCAAACGACAAATCTACCGGGTTA
AAGAAATTGGCAACACAGTTTCTGGGCGCAAAGGTGCAGA
TGACTCGATGACGCTTCAGTCACAAAGCTTTCAGATCGGA
GATTATCTTGACATTGCCATCACTCCGCCTAACCGCGCAC
CGCCTCTCCAAGGACGCATGAGGCCCTACTGACCTGAAAC
AACACTTGACTGCATTTAAATGAAAGGGGTGAAGTCTGTC
TTCCTGCAGAGTTTAGTTCAGCCCTTGTCTGAGCTTTTCA
GGTGAACTGCAAGACTTTGATTTGATCGAGTGTTTATGTC
GGAACTAAACTCTGCAGGAAGGTTTATGCAGAATAGCAGC
ATGATTGAGCTGATAATCTCGATTTGGAAGTAAAAAGGAA
AGTCTTTTCATATATTATGTTCTTTGTGGAGTTTTTTATC
AGATCTACCTTTTTAGTTCTAGTCCTGTTAGCGTGATTCA
AATCATTCATGAATAAATGTTTTTTTTTTTCAGTA

sap18 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA sap18-201 875
ncRNA sap18-002 (1)    Ensembl 1714
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sap18-201 Contained in:
[BAC] RP71-68N21 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000025667 (1),  Ensembl_Trans:ENSDART00000080604 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC059482 (1) 855 bp
GenBank:BM026030 (1) 631 bp
GenBank:EB800225 (1) 462 bp
CITATIONS (2)