Community Action Needed: Please respond to the NIH RFI
Transcript

matn4-202

ID
ZDB-TSCRIPT-090929-8289
Name
matn4-202
Previous Names
  • matn4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025559 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025559|OTTDARG00000020439|ZDB-GENE-050208-64 matn4|OTTDARP00000021015 matn4-001 LG_none AL954861.11,BX957318.7 Danio rerio protein_coding KNOWN, 3744 bp
TCTCCACCTACAGCAACTGGGGTTTTTGTGGTGAGATTGG
GCCTTTGTCGACGAAACATGACACGTGTGTTGGTGTATGT
CAGTGTGCTATTAGCCGTAATGGCTGCAACGGAAGCAAGG
CCTAAATCAGGTGAACCAAAGTGTAAATCTGGCCCGGTTG
ACCTTGTGTTCATCATTGATGGCTCCCGCAGCGTTCGTCC
GCACGAGTTTGAGACGATGCGCAAGTTCATGATTGACATC
ATCCATGAGCTGGACATTGGTTTAGCGGCAACTCGAATCG
GTGTGGTCCAATACTCCAGCCAAGTCCAGAACGTGTTTTC
CCTGAAAGCATTCAGCAAGACAGAGCAGATGGTCAAAGCC
ATCAACGAGATCATTCCTCTGGCGCAGGGCACAATGACCG
GCCTGGCCATCCGATACGCCATGAACGTGGCTTTTTCGGC
TGAAGAAGGTGCCCGTCCCAATGTTCCCCATGTTGCTGTG
ATCGTGACGGATGGTCGGCCTCAGGACCGAGTGGCTGAAG
TGGCAGCTGCTGCCAGAGAGTCTGGAATCGAGATCTACGC
TGTGGGTGTGGCCAGAGCCGATATGACCTCACTCAGAGCA
ATGGCGTCTCCTCCGTTTGAGGATCACGTGTTTTTGGTGG
AGAGTTTTGACCTTATTCATCAGTTTGGGCTTCAGTTCCA
AGACAAGCTCTGCGGGATGGACTTGTGCCTGGAGTCCGAT
CATGGCTGTGAGCACATCTGTGAGAGCTCACCCGGCTCCT
ACCAGTGTCTGTGTCTGCCTGGTTACACACTCAATGAAGA
CGGCAAAACCTGCACACCCATTGATCTGTGTGCTGAAGGG
AAACATGACTGTGAGCAAATCTGCATCGCCTCGCCGGGGT
CTTTCACCTGCGACTGTAACACGGGATACACACTCAATGA
CGACAAGAAGACCTGCAAAATGATCGACTACTGCTCATTT
GGGAATGACAGCTGCGAGCACAAGTGTGTGAGTGTGTTAA
ACGGCTTTAACTGTCGCTGTGATGAAGGATACTCACTCAA
TGAGGACCTGAAAACCTGCACAATGATCGACTACTGTTCA
TTTGGGAATGATAGCTGCGAGCACGAGTGTGTGAGTGTGC
TTCAGAGCTTTTACTGCCAATGCCGAGACGGATACACACT
CAACGAGGATGAAACAACATGCACAATGATCGACTACTGT
TCATTTGGAAATGATAGCTGCGAGCACGAGTGTGTGAGTG
TGCTTAACGGCTTTCACTGTCGCTGTAATGAAGGATACTC
GCTCAATGACGACCTCAAGACCTGTACAATGATCGACTAC
TGCTCGTTTGGGAATGATAGCTGCGAGCATGAGTGTGTGA
GCGTTCTGAAAGGCTTTCACTGCCGCTGTAATGATGGATA
CACACTCAACGATGACAAGAAGACCTGTACAATGATCGAC
TACTGCTCGTTTGGGAATGATAGCTGCGAGCATGAGTGTG
TAAGTGTGCTCAAAGGCTTTCACTGCATTTGTAACGAGGG
ATACTCGCTCAACGATGACAAGAAGACCTGTACAATGATC
GACTACTGCTCGTTTGGGAATGATAGCTGCGAGCACGAGT
GTGTGAGTGTGCTCAAAGGCTTTCACTGCATTTGTAACGA
TGGATACTCGCTCAACGATGACAAGAAGACCTGTACAATG
ATCGACTACTGTTCATTCGGGAATGATAGCTGCGAGCACC
AGTGTGTTAGTGTGCTCAAAGGCTTTAACTGCCGCTGTAA
TGAAGGATACTCGCTCAATGGCGACCTCAAGACCTGCACA
ATGATTGACTACTGTTCATTTGGGAATGATAGCTGTGAGC
ATGAGTGTGTGAGTGTCCTCAATGGTTTTCACTGCCGTTG
TAAGGACGGATACACCCTCAATGAGGACAAGAAGACCTGT
ACAATGATCGATTACTGCTCCTTTGGGAATCACAGTTGTG
ATCATCACTGTGTTAGTGTGCTCAATGGCTTCTTCTGTCG
CTGCAATGAAGGATACACTCTTCAGGAGGATGGAAAGACC
TGCCAGTCGGATAACTTATGCAACACAGTTGAGCATGGTT
GCGAGTACCAGTGTGTGAGTACTCCAGGATCATACCACTG
CATCTGTCCTGAGGGTCACGTGCTGCAGGACGACGGCAAG
AGCTGTGGAACTTGTCGAACCTCCAACATCGACCTGGTCC
TGCTCATCGATGGCTCCAAGAGTGTCCGGCCGCAGAATTT
TGAGCTGGTCAAGCAGTTTGTGAACCAGGTGGTGGATCAG
CTGGACGTCTCTGCTAAAGGCACACGTGTGGGACTCGTCC
AGTACTCCAGCCGCGTGCGCACAGAGTTCCCGCTCAGCAT
GTACCACAGCAAAGATGAGATCAAGAAGGCCGTGATGAAT
GTGGAGTACATGGAAAAGGGCACCATGACAGGCCTGGCCC
TCAAACACATGGTGGAGAACAGCTTCTCTGAGGCCGAAGG
AGCACGTCCTGCTGAGAAAAACATCCCGCGGGTCGGCCTG
GTGTTCACTGATGGACGCTCACAGGATGACATTCAGGAGT
GGGCCAAGAAAGCCAAGGAAGCAGGAATCACCATGTATGC
AGTTGGAGTGGGTAAAGCAGTGGAGGATGAGCTGAGAGAG
ATTGCATCTGATCCAGTGGAGAAACACTTCTTCTACAGCG
CAGACTTCACTGCCATCAGCCAGATTGCAGAAAACCTCAA
ACTCAACGTCTGCGCAGCGGAGAGTAAAGGAGACATCGAG
GTGAAAGATCCCTGTGCCTGTGAGAGTCTGGTGGAGTTTC
AACAGGTCACGATGTCCACCATTGAGCAGCTCAACCAGAA
ACTGTCAGCCATGACCAAGCGATTGGAAGTTCTGGAGAAG
CAGTTGCTCTGAAGACAATGAGCGAAAAATCCTGAAACAC
ACAGCAGCAGTGAGGAGGAGGAGGAGGACGGGGCCCGTCG
GGTGTGAAGGGGCTCTCAGTACAGACATCTACAGGTCGAA
CATCTGAGGCACGAGGCCTAATATTTCCACTGCCATTTCT
GGACATGGCTCATATTGTTCCCTGTTTATACATGATCTGT
ATTGTACGGTTTGTAGAGAGTTATATATTTATGACAAATT
TGATAATAGCATTTATACACTAAAAAGGGAAATGAAGTGG
TACCACTCTGAAATATTGTTTGCTTTGATTGTTTTGTTTT
GGCACCAAATGTGAAACTATAGAAACGTACGTCTATGCAC
AAAAAATTACAAAAACAGATACGCATTATACTGTTGTACA
GTCTTAAAATCATTAGTTTACAAAATACTAAAACCAAAAG
AGACAATTTAGTGTCTGCATGAACATTTTTTAATATGTGT
ATTTCTTGTACTGGACTGCAAAGTTTTTGTTTTTGACCCA
AGAATGGCCTGAATGATTTGTTAACACTAAAAAAGGAGAT
TTGATTTGTGTGAACACAGGGTAATGTGTACAAGTGCCCC
TTAAGATTGCAGTTTTTTATTATTGTTGTTATTATTAAGA
GCAATTTACAGAATCCAAGTCCGATACCTCAGAGTTTTCT
GGCCTAAGGTTTTTGTTTTATAGACGTTTGCAAAAAAAAT
TATAATAATGGCCCCATTATAAGGCTTTGACAGTATATGT
GAATTCTTGTACTTTTTGGATATTTCCTAATAACACTCTT
TTTAAAAACTTTTAAAGTGTGTCTGTGTTCATTCACAGTG
TGAAATAAATACATTTTCAACATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations