Community Action Needed: Please respond to the NIH RFI
Transcript

axin2-202

ID
ZDB-TSCRIPT-090929-8092
Name
axin2-202
Previous Names
  • axin2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025343 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025343|OTTDARG00000020301|ZDB-GENE-000403-2 axin2|OTTDARP00000020854 axin2-001 LG_ BX088708.14 Danio rerio protein_coding KNOWN, 3515 bp
TGCGCTCTTTGATGTCCGCTCTTAAACCCTGAGCTCAGTC
CACACTGGAATAAGAGACCAGAGCACATTCAACACACTAT
ACAGGGATCCAGTGTGTTCTTTACGGGAGGAAGAGTACGT
TTAAAAGCTCCAATCTGCGTTTGACACTAAACAACACCAG
AGAACAGAAGGACGTGCAAAATTGGATATATTGTGGATTA
TTTTTTTGTTCGGTTGGAAGATCGGGACTTTACGGACTGA
ACTCATGGATGGATGAGAGAAGCTCCCCTGCTGATTTAAG
AGAGAGAGGAGATTACAGCTGAGCTTCACACTGAAGGCTT
TGCTGCTGGAGCTGCAAGAGCCATGAATAGGACACTAACA
GATCCTATGGTCAGTAGCTTCAGAGAAGATGACCCACGTC
CACCGGTCCCAGGGGAAGAGGGTGAGACGACATGCCACCA
TCCCAGCAAACTGGCCATGATGAGACCGAAGGATCCTGTC
AAGACCATTATGGCTGATCTTCGTTGTTCCACGGCCAGGA
GGGATGAGGATGGACTTGGGGAACCTGAGGGCAGCGCATC
CCCGGACTCCCCTCTTGCCCGGTGGACCAAATCTTTGCAT
TTTCTTCTCGGGGACCAGGATGGTGCTCAACTTTTCCGGG
CATACCTTGAACGCGAGAAATGTGTGGACACTTTAGATTT
TTGGTTTGCCTGCAATGGTTTCAGACAAATGGACCTCAAG
GATACCAAAACGCACAGAGTTGCCAAAGCCATTTACAAGC
GGTATATTGAGAACAACAGCATTGTGGCCAAGCAGCTTAA
ACCTGCCACTAAGACCTTTATTAGGGATAATATTAAGCGT
CAGCAGATTGACTCTGCAATGTTTGATCAGGCTCAAATGG
AGATCCAGACGGCTATGGAGGAGAATGCCTATCAGATGTT
TTTGACCTCGGACATATACCTCGAGTATGTCAGAACTGGG
TGCGAGAACCCCAGTCATGTGAATCCCAATGGTCTAGGAG
GTCTAAAGCTGGTGTGCGGATACTTGCCAACTTTAAATGA
AGAAGAAGAGTGGAGTTGTAATGACTTTAAAGCCAAAGCT
TTGGCCACTGTAGTGGGTCTGTCTGCCAAAACACTACGGT
CACCACCTCTTCGTGCTGTGGAAGCACTGGAGAAAGGCTA
CAGGTCCTACAGACGCAGTGACCCCGGAAATCCTAATCGT
TTTACGTCCGGTTATAGTTTTGCCCCTGCCACGAGTGCCA
ATGACAGTGAAGTTTCTAGTGATGCACTGACGGATGACTC
CATGTCAATGACAGACAGTAGTGTAGATGCCATTCCTCCT
TACAAGCTGGGAAGTAAAAAACAATTACAACGAGAGATGC
AGCGCAACATGAGGATGAACGGCCAAGTGTCTCTGCCTCC
GTTCCCTAGGACGCGGCGGCCACCTAAGGAGATGACTCCC
GTGGAGCCAGCAGCCTTTGCAGCACAGTTGATAGCCAGAC
TGGAGCGACTGAAGCGGGAACAGGAAACCATGAGCTCCCT
GGAGGAGAGACTTCAACAGATTCAGGAGGAGGAAGAGCGA
GATGAATCTGAGATGTCTAGTAGCAGTGCGTCCCATTCTC
TGCCTTTGCTCCCTCCTGGCACTTGTGAGGAGGATCCTCA
GGCCATCCTGGACGAGCACCTTTCCAGAGTCCTCAAGACC
CCTGGCTGTCAGTCTCCAGGATTGCTTCGACATTCCCCAC
GCTCTCGCTCTCCTGAACAGCGTCCCCTGCCTCGGGGAGG
TCTCAGCACAAGGTCACAGTCTAGCTCTATGAATGGATAT
GTGCCAGCCAAGACCTTCATTTCTAGACAGTCAACCAAGC
ACATCCATCACCACTACATCCATCACCATGCTGGGCCTAA
AAGCAAGGAGCAGATTGAGGTGGAGGCGACACAGCGGGTA
CAGTGCCTGTGCCATGGAACCTCAGAATGCTGCACTGCTC
CTTACATTCGCAGCCGGAGTCTGGGCAGAGACCAGTGTGC
CAGCCCTGCAGAAGTGGCCTTGGGGCATTCCAGTACTTTA
TCCAAGCGTCTGTGTAAATCTGGAGAGGAGGTGAACATGG
AAGGGCTGGAGAACAGTCTCCTCCAGCTGCCAGCTGACAG
TACAGATCGCTCTCAAAATGTATGGCAATGGATCCTGGAG
AGCGACCGACAAACCAAGCACAAGCCCCACAGCACTCAAA
ATGTAAAGAAGTCGCACAGTTTGGAACCAACGCGCACGCA
CACCTGGGGAGGTGGCGGAAGCAGTGGGCATCTCCGTGCC
CACCAGCCCGCACACCCCTTTGTTCAGGACCCCGCCATGC
CACCTCTACCCCCTCCCAACACCTTAGCACAGCTTGAAGA
AGCCCGCAGACGCCTGGAGGAAGTTTCCAAACCCTCAAAA
CAAAGGCATTCAACATCAAGCCTTCAGAGAGACAAGAGTC
ACCCAGTGCCTGTTCAGAATGGCAGTTCAGCATTTCCAAT
GGACGAAAGGAAAGATCCTAAGAAGATGTCAGGCTGTCAC
AGTAGTTTGGGCTCGGAGACGGTAGTCACGTACTTCTTTT
GTGGTGAGGAAATCCCATATCGGCGGATGATGAAAACACA
CAGCCTTACCCTCGGACACTTCAAGGAACAACTACGGAAA
AAAGGCAACTACAGATACTTCTTCAAAAGGGCCAGTGATG
AGTTTGAGTGTGGTGCTGTGTTCGAGGAGGTCTGGGATGA
CTGCACAGTTCTGCCAATGTATGAGGGCAAAATCCTCGGC
AAAGTGGACAGAATGGACTAAAAGGACACGTGGAATTACC
CAGCACTCGAAACTAACTCAAGGAGCTAGAGCTTCATAAC
TCAAAACGGATGTCCAATGAAGACGTTTGGCTTACAAGCT
ATTGAAGGAATACTGGCCAATGAAGTACAGAGGGATCTGA
ACCAGCGGGAAAACTACGACGAGAGATGTTCTAACCAATG
AAGACTCGGTCAACTATTCGCTTATTCGGACTACAATTCG
CCAACTTTGCTGTGTTACCAGAACGTGGACTGCTGACCAG
CATTCGTGATGATAATTGTAGATGTGTGTACATGTGTTGG
ATGCAAGAACGTGTGCATGTGTATACAGAGGTGCTCCTAT
GTACACAGTTATAATATGCTTCTATCACAAGTTAAAGACT
TTATTACTATTTATTAAACTGTCATTCCCCTCATACCTGT
GTTCAGATGATGGACAAGCTGCTTATTTTATTGGGAGATT
TTTTTCCAATGTCGACTCAACAGACTGTACCAGGAACCTT
CTCTTCTGACCAATGAGAACAAACTGTGCTTTAGACCAGC
ACGCCTCTGCAAGCCTCTCAGCTGATATGGTGGATATTTC
AACCTTTATCCCCCAGCCAATAGCCGATGATGTGTTGCAT
CTTTAGTGCCTTTGGTTTAAGGTCCAGACATTGCACAGGA
ACCAGTAGCCTTGTCCTGGAGCCTACTCCAAAACTATTTA
AATGAACAATAGTAATAAAAAGACACACTATTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations