header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7883
Transcript Name: aldh1a2-201
Previous Name: aldh1a2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025116 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025116|OTTDARG00000020177|ZDB-GENE-011010-3 aldh1a2|OTTDARP00000020679 aldh1a2-001 LG_ CR392043.5 Danio rerio protein_coding KNOWN, 2259 bp
AACACAGGAAGGATTCCAAAGTTGTAATCGCACATCGGCA
GGGGAAAAAAACCCAACCGGCATCTTCAATAGACGCGATG
ACCTCCAGTGAAGTTGAACTGCCAGGAGAGGTGAAGAACG
ACCCGGCTGCGCTCATGGCATCTCTCCATCTGATGCCCTC
ACCGGTACCCAATCCTGAGATCAAGTACACCAAGATTTTT
ATTAATAATGAATGGCATGATTCTGTGAGCGGCAAGGTCT
TCCACACGTACAACCCTGCCACAGGAGAGAAGATCTGTGA
TGTCCAGGAATCCGACAAGGCTGATGTGGATAAAGCTGTG
CAGGCTGCACGTTCGGCCTTCTCTCTGGGTTCAGTATGGA
GGAAGATGGATGCATCTGAACGGGGGAAGCTACTGTTCAA
ACTGGCTGATCTGGTGGAGAGAGACAGTGCTTACCTTGCT
ACCCTGGAGTCTCTGGACAGCGGCAAACCTTTCCTCCCCT
GCTTCTTTGTGGACCTTCAGGGGATCATTAAAACATTTCG
ATATTACGCTGGATGGGCAGATAAGATCCACGGGTCTACA
ATTCCAATTGATGGAGAATTTTTCACCCTCACCAGACATG
AGCCCATTGGAGTGTGTGGACAGATCATTCCTTGGAACTT
CCCCCTGGTGATGACAGCATGGAAATTGGGGCCGGCGCTG
AGCTGCGGGAACACGGTTGTCCTGAAACCTGCTGAGCAAA
CCCCTCTCACCTGCCTCTACCTCGGCGCTCTGATCAAAGA
GGCTGGGTTTCCACCGGGAGTCGTCAATATTTTGCCAGGC
TATGGGCCAACCGCAGGAGCCGCGATCTCTTCGCACATGG
GCATAGACAAAGTGGCGTTCACAGGATCGACTGAGGTAGG
CAAGCTGATCCAAGAAGCAGCAGGAAAGAGCAATCTGAAG
AGAGTCACGCTGGAGCTCGGGGGAAAGAGTCCCAACATCA
TTTTTGCAGATGCTGATTTTGAGCTGGCATTAGAACAGGC
CCATCAGGGGGTTTTCTTCAATAACGGTCAATGCTGCACT
GCTGGTTCCCGTATCTTTGTTGAGGAGCCCATTTATGATG
AGTTTGTGAGAAGAAGTGTTGAGAGAGCACAGAGGAGGAA
AGTGGGAAATCCCTTTGACCCAACCACTGAACACGGACCT
CAGGTGAGCGAGGAGCAGCAGAGACGTGTGCTGGAGCTCA
TCCAGAGTGGCATCACTGAAGGAGCCAAACTGGAGTGTGG
AGGCAAAGCTCCTCCTACTAAAGGCTTCTTCGTGGAGCCC
ACAGTTTTCTCTAATGTGAAGGACCACATGCGCATCGCCA
AGGAGGAGATATTTGGGCCAGTGCAGCAAATCATGAAGTT
CAAAACAATTGAAGAAGTGATTGAGAGAGCCAACAACACA
GAATACGGTCTGGCAGCGGCCGTCTTCACCAGAGATATCA
GCAAGGCCATGACCATCTCTGCAGCAGTGCAGGCCGGCAC
CGTCTGGATTAACTGTTATAACGCCCTGTCCTGCCAGTGT
CCTTTCGGAGGATTCAAAATGTCCGGCAATGGCCGTGAAC
TCGGAGAGATCGGACTGAAAGAGTACACAGAGCTGAAAAC
CATTACGATGAAGATGTCAGGCAAGACGTCTTAAAGCACA
GACATGTACATGTTCGTTGCAGCTGGAAGTCTTGATGTTA
GCCGTTATCCTTTGGTGGGGTATAGTGGTAAAACGCAGTG
AACCACCCATCACTTCTGCATTGGAGCGCCTCTTCTGCTG
CATCCTCATAGGCTGTTATCATAAACTACCCTTCATCTCC
ACCTCCACCATTAACTGCCTACACCCATTCCAGCTGTGTG
TCCCCCTTTCACCGGCTCCACTAACCATACTAAAGCACTC
GGGGTCCCGGTGAAGGAGGGCCATGCTTTTGACCACCGCA
CCAGCAGCGTGCAGACACTAACAGACTGTGACTTCTCTTT
CAATCTCAATCTCTGATCATCTTCTGCATCAAGAGGTTCG
ATGTTTCAGAGACGTGTCATTCTCAAACCTCATCATTAAC
TTACCTTTCCACTGGGTAGAAATCGAGTAGGCATATTAGT
TTGTACTAAGACCACTGAAGCTCTCAGAAAAAAAGATGTT
TTCATCGAATGAGTATTAATTCTTAAATTTGTGTAATTGT
TTTTTATTTCATTGTTTGATTGTTTTTACAATGTATAACT
TTGTCGATGTCTTGACCAATGTAAACAAAAATGTTTTACC
TCTGAAAAAAAAAAAAAAA

aldh1a2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA aldh1a2-201 3252
ncRNA aldh1a2-002 (1) 699
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aldh1a2-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000025116 (1),  Ensembl_Trans:ENSDART00000075519 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AF339837 (1) 2244 bp
GenBank:BC045851 (1) 2236 bp
GenBank:AF315691 (1) 2233 bp
GenBank:AF288764 (1) 2183 bp
GenBank:EB845379 (1) 462 bp
CITATIONS (2)